@551656AS34@ Multisite Gateway Vectors 267|James Caffrey 212 25|pcDNA6.2v5PL-DEST 27|0 222|3 33|6693 236|393342819 237|416245341 26|616 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 930 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="930" 50 45 51|4 52|Amp(R) 53|1 55|5583 56|6443 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|25 52|SV40 pA 53|0 55|4252 56|4382 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|29 52|SV40 promoter and origin 53|0 55|3266 56|3574 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|28 52|T7 promoter/priming site 53|0 55|96 56|115 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|86 52|attR1 53|0 55|144 56|268 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|0 55|2286 56|2410 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|4 52|ccdB 53|1 55|697 56|1002 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|V5 Epitope 53|0 55|2436 56|2477 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|28 52|V5 reverse priming site 53|0 55|2445 56|2465 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|25 52|Tk polyA signal 53|0 55|2504 56|2775 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1860000" 50 45 51|33 52|f1 origin 53|0 55|2811 56|3239 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="250000" 50 45 51|30 52|EM7 promoter 53|0 55|3629 56|3695 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2340000" 50 45 51|4 52|Bsd(R) 53|0 55|3696 56|4094 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1050000" 50 45 51|33 52|pUC origin 53|1 55|4765 56|5438 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2530000" 50 45 51|30 52|bla promoter 53|1 55|6444 56|6542 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|Cm(R) 53|1 55|1325 56|2005 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 205 37|0 38|0 39|0 40|0 250 248| 248| 248| 50 1024|-1 24 209|agtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaagctatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccccctgccactcatcgcagtactgttgtaattcattaagcattctg 209|ccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggttagtaatgagtttaaacgggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacgggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagaccccattggggccaatacgcccgcgtttcttccttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagcagatctgcgcagctggggctctagg 209|gggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctgcatcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtgggagggctaagcacttcgtggccgaggagcaggactgacacgtgctacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggc 209|tggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcag 209|tgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagt 210 212 25|pDONR221-P1P4 27|0 222|3 33|4774 236|399124296 237|416244959 26|617 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 34|Complementary copy of pDONR221-P1P4 rc 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 920 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="920" 50 45 51|86 52|attP1 53|0 55|570 56|801 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2685000" 50 45 51|4 52|ccdB 53|1 55|1197 56|1502 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|86 52|attP4 53|1 55|2753 56|2984 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2688000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse Primer Binding Site 53|1 55|3039 56|3055 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|4098 56|4771 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|3168 56|3977 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|Cm(R) 53|1 55|1825 56|2505 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggg 209|gatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggata 209|tgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcaacttttctatacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgc 209|cggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONR221-P1P5r 27|0 222|3 33|4765 236|399123546 237|416243884 26|618 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 34|Complementary copy of pDONR221-P1P5r 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 918 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="918" 50 45 51|4 52|Cm(R) 53|1 55|1825 56|2505 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|3030 56|3046 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|4089 56|4762 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|3159 56|3968 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|ccdB 53|1 55|1200 56|1502 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|86 52|attP1 53|0 55|570 56|801 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2685000" 50 45 51|86 52|attP5r 53|0 55|2753 56|2984 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2689001" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggg 209|gatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgacaaataatgattttattttgactgatagtgacctgttcgttgcaacaaa 209|ttgatgagcaatgcttttttataatgccaactttgtatacaaaagttgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtactgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaag 209|agctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONR221-P3P2 27|0 222|3 33|4774 236|391339286 237|416244976 26|619 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 922 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="922" 50 45 51|4 52|ccdB 53|1 55|1200 56|1502 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|86 52|attP3 53|0 55|570 56|801 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2687000" 50 45 51|86 52|attP2 53|1 55|2753 56|2984 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2686000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|3039 56|3055 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|4098 56|4771 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="250000" 50 45 51|4 52|Km(R) 53|0 55|3168 56|3977 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|Cm(R) 53|1 55|1825 56|2505 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtataataaagttgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggg 209|gatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggata 209|tgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgc 209|cggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONR221-P4rP3r 27|0 222|3 33|4717 236|391339185 237|416244930 26|620 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 921 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="921" 50 45 51|4 52|ccdB 53|1 55|1152 56|1454 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|86 52|attP4r 53|1 55|570 56|801 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2688001" 50 45 51|86 52|attP3r 53|0 55|2705 56|2936 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2687001" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|2982 56|2998 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|4041 56|4714 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|3111 56|3920 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|Cm(R) 53|1 55|1777 56|2457 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggcccctacaggtcactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcaacttttctatacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatc 209|cacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgacaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtataataaagttg 209|aacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtactgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcaga 209|taccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONR221-P5P2 27|0 222|3 33|4774 236|391339475 237|416244886 26|621 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 919 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="919" 50 45 51|86 52|attP5 53|0 55|570 56|801 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2689000" 50 45 51|4 52|ccdB 53|1 55|1197 56|1502 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|86 52|attP2 53|1 55|2753 56|2984 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2686000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|3039 56|3055 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|F1 origin 53|0 55|4098 56|4771 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|3168 56|3977 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|Cm(R) 53|1 55|1825 56|2505 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtatacaaaagttgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggg 209|gatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggata 209|tgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgc 209|cggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONR221-P5P4 27|0 222|3 33|4774 236|391339046 237|416244910 26|622 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 923 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="923" 50 45 51|86 52|attP5 53|0 55|570 56|801 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2689000" 50 45 51|4 52|ccdB 53|1 55|1197 56|1502 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|86 52|attP4 53|1 55|2753 56|2984 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2688000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|3039 56|3055 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|4098 56|4771 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|3168 56|3977 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|Cm(R) 53|1 55|1825 56|2505 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtatacaaaagttgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggg 209|gatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggata 209|tgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcaacttttctatacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgc 209|cggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR L1-pLac-LacZalpha-L4 27|0 222|3 33|2916 236|410544608 237|416245012 26|623 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 34|Complementary copy of pDONR221-P1P4 rc 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 926 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="926" 50 45 51|86 52|attL1 53|0 55|570 56|665 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attL4 53|1 55|1031 56|1126 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2682000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|1181 56|1197 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|2240 56|2913 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|1310 56|2119 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|LacZ alpha fragment 53|0 55|768 56|983 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1240000" 50 45 51|30 52|pLac 53|0 55|670 56|767 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2360000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtacaaaaaagcaggctagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagctaacactataaaaagctgatgcagacggggcttttttatgcaggacccaacttttctatacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatg 209|tcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctc 209|tgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR L1-pLac-LacZalpha-R5 27|0 222|3 33|2968 236|401119124 237|416588809 26|624 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 34|Complementary copy of pDONR221-P1P5r 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 924 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="924" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|1233 56|1249 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|2292 56|2965 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|1362 56|2171 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|86 52|attL1 53|0 55|570 56|665 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attR5 53|0 55|1031 56|1154 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2703000" 50 45 51|30 52|pLac 53|0 55|670 56|767 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2360000" 50 45 51|4 52|lacZ alpha fragment 53|0 55|768 56|983 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1240000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtacaaaaaagcaggctagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagctaacactataaaaaggcagtgatgcagacggggcttttttatgcaggcaactttgtatacaaaagttgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtactgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgatta 209|aattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagct 209|tccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR L3-pLac-Tet-L2 27|0 222|3 33|3901 236|401119562 237|416245068 26|625 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 928 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="928" 50 45 51|86 52|attL3 53|0 55|570 56|665 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2681000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|2166 56|2182 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|3225 56|3898 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|2295 56|3104 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|Tet (R) 53|0 55|768 56|1958 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2450000" 50 45 51|30 52|pLac 53|0 55|670 56|767 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2360000" 50 45 51|86 52|attL2 53|1 55|2016 56|2111 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtataataaagttggttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatattgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgcataaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcataggcttggttatgccggtactgccgggcctcttacgggatatcgtccattccgacagcatcgccagtcactatggcgtgctgctagcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgcttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtggatcctctacgccggacgcatcgtggccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggctcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggcgccatctccttgcatgcaccattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagagcgtcgaccgatgcccttgagagccttcaacccagtcagctccttccggtgggcgcggggcatgact 209|atcgtcgccgcacttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgctctgggtcattttcggcgaggaccgctttcgctggagcgcgacgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagccttcgtcactggtcccgccaccaaacgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgttcgcgacgcgaggctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggtagatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcgatcattggaccgctgatcgtcacggcgatttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtgcatggagccgggccacctcgacctgacactataaaagccccgcctgcagtgatgcagacggggcttttttatgcaggacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaa 209|tggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR L5-lacI-L4 27|0 222|3 33|3747 236|407668961 237|416244914 26|626 28|0 219|0 220|1 221|1879 29|0 30|0 217|0 31|0 32|1 34|attL4-attL5 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 929 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="929" 50 45 51|21 52|attL4 53|1 55|1862 56|1957 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2682000" 50 45 51|21 52|attL5 53|0 55|570 56|665 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2683000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|2012 56|2028 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|3071 56|3744 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|2141 56|2950 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|lacI 53|0 55|765 56|1856 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1220000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtatacaaaagttgtgtcgcataagggagagcgtcgagatcccggacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaa 209|attcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcacccaacttttctatacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatc 209|gcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR L5-pLac-Spec-L2 27|0 222|3 33|3713 236|401119206 237|416588520 26|627 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 925 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="925" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|1978 56|1994 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|3037 56|3710 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|2107 56|2916 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|86 52|attL5 53|0 55|571 56|665 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2683000" 50 45 51|21 52|attL2 53|1 55|1828 56|1923 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 45 51|4 52|Spect(R) 53|0 55|768 56|1778 57|0 281|1 282|1 283|1 284|1 50 45 51|30 52|pLac 53|0 55|670 56|767 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2360000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtatacaaaagttggttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatattgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgcatcgctcacgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcatggcttgttatgactgtttttttggggtacagtctatgcctcgggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaaacattatgagggaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgcaaggcttgatgaaacaacgcggcgagctttgatcgacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaa 209|gcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataacactataagggcggatgatgcagacggggcttttttatgcaggacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatgga 209|actgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR R4-pLac-Spect-R3 278|GenBank 27|0 222|3 33|3889 236|410526447 237|416245113 26|628 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 256 224|Invitrogen 225|(800)-357-3114 226|(760)-602-6500 228|ftp://ftp.bioinformatics.invitrogen.com 227|bioinfosales@invitrogen.com 229|http://www.invitrogen.com/bioinformatics 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008 U.S.A. 50 1001|0 1006|15-Aug-2006 1008|SYN 45 51|98 52|Invitrogen vector 927 53|0 55|1 56|4774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="927" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|28 52|M13 Forward (-20) primer binding site 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|31 52|M13 Forward (-40) primer binding site 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|28 52|M13 Reverse primer binding site 53|1 55|2154 56|2170 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|f1 origin 53|0 55|3213 56|3886 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Km(R) 53|0 55|2283 56|3092 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1200000" 50 45 51|4 52|Spect(R) 53|0 55|829 56|1839 57|0 281|1 282|1 283|1 284|1 50 45 51|86 52|attR3 53|0 55|1952 56|2075 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2701000" 50 45 51|30 52|pLac 53|0 55|731 56|828 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2360000" 50 45 51|86 52|attR4 53|1 55|603 56|727 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2702000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggcccctacaggtcactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcaacttttctatacaaagttggttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatattgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgcatcgctcacgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcatggcttgttatgactgtttttttggggtacagtctatgcctcgggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaaacattatgagggaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacat 209|tcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagggaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataacactataagggcgaattctgcagatatccatcacactggcggccgccagtgtgatggatatctgcagaattcgcccttcatcactgcagacggggcttttttatgcaggcaactttgtataataaagttgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtactgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgt 209|tgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 207