@551656AS34@ Invitrogen Gateway vectors 267|Shao-Min Yuan 212 25|BaculoDirect Linear DNA 27|1 222|1 33|139370 236|38836800 237|326807313 26|871 28|0 219|0 220|1 221|1 29|0 30|2 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Phage 1001|0 1006|9-JUN-2003 1008|SYN 45 51|98 52|Invitrogen vector 757 53|0 55|1 56|139370 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="757" 50 45 51|86 52|attR2 53|0 55|9945 56|10069 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|4 52|V5 epitope 53|0 55|10089 56|10130 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|86 52|attR1 53|0 55|4577 56|4701 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|4 52|lacZ 53|0 55|6855 56|9929 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1230000" 50 45 51|4 52|TK gene 53|1 55|4988 56|6118 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1320000" 50 45 51|29 52|ie-0 promoter 53|1 55|6147 56|6698 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2230000" 50 45 51|29 52|p10 promoter 53|0 55|6746 56|6843 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2240000" 50 45 51|60 52|Ac-ptp 53|0 54|AcOrf-1 55|503 56|1009 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-ptp" 50 45 51|4 52|CDS(Ac-ptp)_1 53|0 54|PTP; 19288 kD primary translation product 55|503 56|1009 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-ptp"|/codon_start=1|/product="protein tyrosine phosphatase"|/protein_id="AAA66631.1"|/db_xref="PID:g559070"|/db_xref="GI:559070" 50 45 51|60 52|Ac-bro 53|1 54|AcOrf-2 55|1041 56|2027 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-bro" 50 45 51|4 52|CDS(Ac-bro)_2 53|1 54|BRO; 37769 kD primary translation product 55|1041 56|2027 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-bro"|/codon_start=1|/product="baculovirus repeated ORF"|/protein_id="AAA66632.1"|/db_xref="PID:g559071"|/db_xref="GI:559071" 50 45 51|60 52|Ac-ctx 53|1 54|AcOrf-3 55|2084 56|2245 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-ctx" 50 45 51|4 52|CDS(Ac-ctx)_3 53|1 54|CTX; 5590 kD primary translation product 55|2084 56|2245 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-ctx"|/codon_start=1|/product="conotoxin-like peptide"|/protein_id="AAA66633.1"|/db_xref="PID:g559072"|/db_xref="GI:559072" 50 45 51|60 52|Ac-pk-1 53|0 54|AcOrf-10 55|12393 56|13211 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-pk-1" 50 45 51|4 52|CDS(Ac-pk-1)_10 53|0 54|PK1; 31978 kD primary translation product 55|12393 56|13211 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-pk-1"|/codon_start=1|/product="protein kinase"|/protein_id="AAA66640.1"|/db_xref="PID:g559079"|/db_xref="GI:559079" 50 45 51|34 52|hr1a 53|0 54|2 copies of 30 bp imperfect palindromic sequence 55|13223 56|13340 57|0 281|1 282|1 283|1 284|1 286|/standard_name="hr1a"|/function="enhancer; replication origin"|/rpt_type=dispersed 50 45 51|60 52|AcOrf-11 53|1 55|13375 56|14397 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-11" 50 45 51|4 52|CDS(AcOrf-11)_11 53|1 54|40093 kD primary translation product 55|13375 56|14397 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-11"|/codon_start=1|/product="AcOrf-11 peptide"|/protein_id="AAA66641.1"|/db_xref="PID:g559080"|/db_xref="GI:559080" 50 45 51|60 52|AcOrf-12 53|0 55|14434 56|15087 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-12" 50 45 51|4 52|CDS(AcOrf-12)_12 53|0 54|25412 kD primary translation product 55|14434 56|15087 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-12"|/codon_start=1|/product="AcOrf-12 peptide"|/protein_id="AAA66642.1"|/db_xref="PID:g559081"|/db_xref="GI:559081" 50 45 51|60 52|AcOrf-13 53|1 55|15114 56|16097 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-13" 50 45 51|4 52|CDS(AcOrf-13)_13 53|1 54|38660 kD primary translation product 55|15114 56|16097 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-13"|/codon_start=1|/product="AcOrf-13 peptide"|/protein_id="AAA66643.1"|/db_xref="PID:g559082"|/db_xref="GI:559082" 50 45 51|60 52|Ac-lef1 53|1 54|AcOrf-14 55|15989 56|16789 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef1" 50 45 51|4 52|CDS(Ac-lef1)_14 53|1 54|LEF1; 30780 kD primary translation product 55|15989 56|16789 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef1"|/codon_start=1|/product="late expression factor 1"|/protein_id="AAA66644.1"|/db_xref="PID:g559083"|/db_xref="GI:559083" 50 45 51|60 52|Ac-egt 53|0 54|AcOrf-15 55|16902 56|18422 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-egt" 50 45 51|4 52|CDS(Ac-egt)_15 53|0 54|EGT; 57033 kD primary translation product 55|16902 56|18422 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-egt"|/codon_start=1|/product="ecdysteroid UDP-glucosyl transferase"|/protein_id="AAA66645.1"|/db_xref="PID:g559084"|/db_xref="GI:559084" 50 45 51|60 52|AcOrf-16 53|0 55|18568 56|19245 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-16" 50 45 51|4 52|CDS(AcOrf-16)_16 53|0 54|encodes 25910 kD primary translation product; delayed early gene 55|18568 56|19245 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-16"|/codon_start=1|/product="AcOrf-16 peptide"|/protein_id="AAA66646.1"|/db_xref="PID:g559085"|/db_xref="GI:559085" 50 45 51|60 52|AcOrf-17 53|0 55|19214 56|19708 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-17" 50 45 51|4 52|CDS(AcOrf-17)_17 53|0 54|18482 kD primary translation product; early gene 55|19214 56|19708 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-17"|/codon_start=1|/product="AcOrf-17 peptide"|/protein_id="AAA66647.1"|/db_xref="PID:g559086"|/db_xref="GI:559086" 50 45 51|60 52|AcOrf-18 53|1 55|19874 56|20935 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-18" 50 45 51|4 52|CDS(AcOrf-18)_18 53|1 54|40870 kD primary translation product; early gene 55|19874 56|20935 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-18"|/codon_start=1|/product="AcOrf-18 peptide"|/protein_id="AAA66648.1"|/db_xref="PID:g559087"|/db_xref="GI:559087" 50 45 51|60 52|AcOrf-19 53|0 55|20937 56|21263 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-19" 50 45 51|4 52|CDS(AcOrf-19)_19 53|0 54|12162 kD primary translation product 55|20937 56|21263 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-19"|/codon_start=1|/product="AcOrf-19 peptide"|/protein_id="AAA66649.1"|/db_xref="PID:g559088"|/db_xref="GI:559088" 50 45 51|60 52|AcOrf-20 53|1 55|21489 56|21698 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-20" 50 45 51|4 52|CDS(AcOrf-20)_20 53|1 54|ARIF-1; encodes 7978 kD primary translation product 55|21489 56|21698 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-20"|/codon_start=1|/product="actin rearrangement inducing factor"|/protein_id="AAA66650.1"|/db_xref="PID:g559089"|/db_xref="GI:559089" 50 45 51|60 52|AcOrf-21 53|1 55|21781 56|22740 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-21" 50 45 51|4 52|CDS(AcOrf-21)_21 53|1 54|ARIF-1; encodes 36555 kD primary translation product 55|21781 56|22740 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-21"|/codon_start=1|/product="actin rearrangement inducing factor"|/protein_id="AAA66651.1"|/db_xref="PID:g559090"|/db_xref="GI:559090" 50 45 51|60 52|AcOrf-22 53|0 55|22777 56|23925 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-22" 50 45 51|4 52|CDS(AcOrf-22)_22 53|0 54|43777 kD primary translation product 55|22777 56|23925 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-22"|/codon_start=1|/product="AcOrf-22 peptide"|/protein_id="AAA66652.1"|/db_xref="PID:g559091"|/db_xref="GI:559091" 50 45 51|60 52|Ac-env-prot 53|0 54|AcOrf-23 55|23989 56|26061 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-env-prot" 50 45 51|4 52|CDS(Ac-env-prot)_23 53|0 54|79857 kD primary translation product 55|23989 56|26061 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-env-prot"|/codon_start=1|/product="copia-like envelope protein"|/protein_id="AAA66653.1"|/db_xref="PID:g559092"|/db_xref="GI:559092" 50 45 51|60 52|Ac-pkip 53|1 54|AcOrf-24 55|26110 56|26619 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-pkip" 50 45 51|4 52|CDS(Ac-pkip)_24 53|1 54|PKIP; encodes 19193 kD primary translation product 55|26110 56|26619 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-pkip"|/codon_start=1|/product="protein kinase interacting protein"|/protein_id="AAA66654.1"|/db_xref="PID:g559093"|/db_xref="GI:559093" 50 45 51|60 52|AcOrf-25 53|1 55|26659 56|27609 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-25" 50 45 51|4 52|CDS(AcOrf-25)_25 53|1 54|36554 kD primary translation product 55|26659 56|27609 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-25"|/codon_start=1|/product="ssDNA binding protein"|/protein_id="AAA66655.1"|/db_xref="PID:g559094"|/db_xref="GI:559094" 50 45 51|60 52|AcOrf-26 53|0 55|27685 56|28074 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-26" 50 45 51|4 52|CDS(AcOrf-26)_26 53|0 54|14644 kD primary translation product 55|27685 56|28074 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-26"|/codon_start=1|/product="AcOrf-26 peptide"|/protein_id="AAA66656.1"|/db_xref="PID:g559095"|/db_xref="GI:559095" 50 45 51|60 52|Ac-IAP1 53|0 54|AcOrf-27 55|28076 56|28936 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IAP1" 50 45 51|4 52|CDS(Ac-IAP1)_27 53|0 54|IAP1; 33320 kD primary translation product 55|28076 56|28936 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IAP1"|/codon_start=1|/product="apoptosis inhibitor"|/protein_id="AAA66657.1"|/db_xref="PID:g559096"|/db_xref="GI:559096" 50 45 51|60 52|Ac-lef6 53|0 54|AcOrf-28 55|28941 56|29462 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef6" 50 45 51|4 52|CDS(Ac-lef6)_28 53|0 54|LEF6; 20388 kD primary translation product 55|28941 56|29462 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef6"|/codon_start=1|/product="late expression factor 6"|/protein_id="AAA66658.1"|/db_xref="PID:g559097"|/db_xref="GI:559097" 50 45 51|60 52|AcOrf-29 53|1 55|29522 56|29737 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-29" 50 45 51|4 52|CDS(AcOrf-29)_29 53|1 54|8569 kD primary translation product 55|29522 56|29737 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-29"|/codon_start=1|/product="AcOrf-29 peptide"|/protein_id="AAA66659.1"|/db_xref="PID:g559098"|/db_xref="GI:559098" 50 45 51|60 52|AcOrf-30 53|1 55|29791 56|31182 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-30" 50 45 51|4 52|CDS(AcOrf-30)_30 53|1 54|54688 kD primary translation product 55|29791 56|31182 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-30"|/codon_start=1|/product="AcOrf-30 peptide"|/protein_id="AAA66660.1"|/db_xref="PID:g559099"|/db_xref="GI:559099" 50 45 51|60 52|Ac-sod 53|0 54|AcOrf-31 55|31296 56|31751 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-sod" 50 45 51|4 52|CDS(Ac-sod)_31 53|0 54|SOD; 16182 kD primary translation product 55|31296 56|31751 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-sod"|/codon_start=1|/product="superoxide dismutase"|/protein_id="AAA66661.1"|/db_xref="PID:g559100"|/db_xref="GI:559100" 50 45 51|34 52|hr2 53|0 54|8 copies of 30 bp imperfect palindromic sequence 55|31769 56|32437 57|0 281|1 282|1 283|1 284|1 286|/standard_name="hr2"|/function="enhancer; replication origin"|/rpt_type=dispersed 50 45 51|60 52|Ac-fgf 53|1 54|AcOrf-32 55|32517 56|33062 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-fgf" 50 45 51|4 52|CDS(Ac-fgf)_32 53|1 54|FGF; 20619 kD primary translation product 55|32517 56|33062 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-fgf"|/codon_start=1|/product="fibroblast growth factor"|/protein_id="AAA66662.1"|/db_xref="PID:g559101"|/db_xref="GI:559101" 50 45 51|60 52|Ac-HisP 53|1 54|AcOrf-33 55|33209 56|33757 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-HisP" 50 45 51|4 52|CDS(Ac-HisP)_33 53|1 54|20838 kD primary translation product 55|33209 56|33757 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-HisP"|/codon_start=1|/product="putative histidinol-phosphatase"|/protein_id="AAA66663.1"|/db_xref="PID:g559102"|/db_xref="GI:559102" 50 45 51|60 52|AcOrf-34 53|1 55|33770 56|34417 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-34" 50 45 51|4 52|CDS(AcOrf-34)_34 53|1 54|24885 kD primary translation product 55|33770 56|34417 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-34"|/codon_start=1|/product="AcOrf-34 peptide"|/protein_id="AAA66664.1"|/db_xref="PID:g559103"|/db_xref="GI:559103" 50 45 51|60 52|Ac-v-ubi 53|0 54|AcOrf-35 55|34438 56|34671 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-v-ubi" 50 45 51|4 52|CDS(Ac-v-ubi)_35 53|0 54|v-ubi; 8653 kD primary translation product 55|34438 56|34671 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-v-ubi"|/codon_start=1|/product="viral ubiquitin"|/protein_id="AAA66665.1"|/db_xref="PID:g559104"|/db_xref="GI:559104" 50 45 51|60 52|Ac-39K/pp31 53|1 54|AcOrf-36 55|34718 56|35545 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-39K/pp31" 50 45 51|4 52|CDS(Ac-39K/pp31)_36 53|1 54|39K; 31282 kD primary translation product; delayed early gene 55|34718 56|35545 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-39K/pp31"|/codon_start=1|/product="nuclear matrix associated phosphoprotein"|/protein_id="AAA66666.1"|/db_xref="PID:g559105"|/db_xref="GI:559105" 50 45 51|60 52|Ac-lef11 53|1 54|AcOrf-37 55|35539 56|35877 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef11" 50 45 51|4 52|CDS(Ac-lef11)_37 53|1 54|LEF11; 13129 kD primary translation product 55|35539 56|35877 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef11"|/codon_start=1|/product="late expression factor 11"|/protein_id="AAA66667.1"|/db_xref="PID:g559106"|/db_xref="GI:559106" 50 45 51|60 52|AcOrf-38 53|1 55|35840 56|36490 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-38" 50 45 51|4 52|CDS(AcOrf-38)_38 53|1 54|25257 kD primary translation product 55|35840 56|36490 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-38"|/codon_start=1|/product="AcOrf-38 peptide"|/protein_id="AAA66668.1"|/db_xref="PID:g559107"|/db_xref="GI:559107" 50 45 51|60 52|Ac-p43 53|1 54|AcOrf-39 55|36554 56|37645 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p43" 50 45 51|4 52|CDS(Ac-p43)_39 53|1 54|p43; 43490 kD primary translation product 55|36554 56|37645 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p43"|/codon_start=1|/protein_id="AAA66669.1"|/db_xref="PID:g559108"|/db_xref="GI:559108" 50 45 51|60 52|Ac-p47 53|1 54|AcOrf-40 55|37653 56|38858 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p47" 50 45 51|4 52|CDS(Ac-p47)_40 53|1 54|p47; 47530 kD primary translation product; nuclear protein 55|37653 56|38858 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p47"|/codon_start=1|/product="transcription regulator"|/protein_id="AAA66670.1"|/db_xref="PID:g559109"|/db_xref="GI:559109" 50 45 51|60 52|AcOrf-41 53|0 55|38857 56|39402 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-41" 50 45 51|4 52|CDS(AcOrf-41)_41 53|0 54|21058 kD primary translation product 55|38857 56|39402 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-41"|/codon_start=1|/product="AcOrf-41 peptide"|/protein_id="AAA66671.1"|/db_xref="PID:g559110"|/db_xref="GI:559110" 50 45 51|60 52|Ac-GTA 53|0 54|AcOrf-42 55|39486 56|41006 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-GTA" 50 45 51|4 52|CDS(Ac-GTA)_42 53|0 54|GTA; 59058 kD primary translation product 55|39486 56|41006 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-GTA"|/codon_start=1|/product="global transactivator-like protein"|/protein_id="AAA66672.1"|/db_xref="PID:g559111"|/db_xref="GI:559111" 50 45 51|60 52|AcOrf-43 53|0 55|41020 56|41253 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-43" 50 45 51|4 52|CDS(AcOrf-43)_43 53|0 54|8816 kD primary translation product 55|41020 56|41253 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-43"|/codon_start=1|/product="AcOrf-43 peptide"|/protein_id="AAA66673.1"|/db_xref="PID:g559112"|/db_xref="GI:559112" 50 45 51|60 52|AcOrf-44 53|0 55|41234 56|41629 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-44" 50 45 51|4 52|CDS(AcOrf-44)_44 53|0 54|15002 kD primary translation product 55|41234 56|41629 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-44"|/codon_start=1|/product="AcOrf-44 peptide"|/protein_id="AAA66674.1"|/db_xref="PID:g559113"|/db_xref="GI:559113" 50 45 51|60 52|AcOrf-45 53|0 55|41631 56|42209 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-45" 50 45 51|4 52|CDS(AcOrf-45)_45 53|0 54|22651 kD primary translation product 55|41631 56|42209 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-45"|/codon_start=1|/product="AcOrf-45 peptide"|/protein_id="AAA66675.1"|/db_xref="PID:g559114"|/db_xref="GI:559114" 50 45 51|60 52|Ac-odv-e66 53|0 54|AcOrf-46 55|42194 56|44308 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-e66" 50 45 51|4 52|CDS(Ac-odv-e66)_46 53|0 54|E66; 79 kD; encodes 79075 kD primary translation product 55|42194 56|44308 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-e66"|/codon_start=1|/product="occlusion-derived virus envelope protein"|/protein_id="AAA66676.1"|/db_xref="PID:g559115"|/db_xref="GI:559115" 50 45 51|60 52|AcOrf-47 53|1 55|44414 56|44680 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-47" 50 45 51|4 52|CDS(AcOrf-47)_47 53|1 54|10482 kD primary translation product 55|44414 56|44680 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-47"|/codon_start=1|/product="AcOrf-47 peptide"|/protein_id="AAA66677.1"|/db_xref="PID:g559116"|/db_xref="GI:559116" 50 45 51|60 52|AcOrf-48 53|1 55|44754 56|45095 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-48" 50 45 51|4 52|CDS(AcOrf-48)_48 53|1 54|12873 kD primary translation product 55|44754 56|45095 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-48"|/codon_start=1|/product="AcOrf-48 peptide"|/protein_id="AAA66678.1"|/db_xref="PID:g559117"|/db_xref="GI:559117" 50 45 51|60 52|Ac-pcna 53|1 54|AcOrf-49 55|45119 56|45889 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-pcna" 50 45 51|4 52|CDS(Ac-pcna)_49 53|1 54|PCNA; 28635 kD primary translation product; the upstream, in-frame, initiation codon at 40498..40500 is not used 55|45119 56|45889 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-pcna"|/codon_start=1|/product="proliferating cell nuclear antigen"|/protein_id="AAA66679.2"|/db_xref="PID:g4376186"|/db_xref="GI:4376186" 50 45 51|60 52|Ac-lef8 53|1 54|AcOrf-50 55|45999 56|48629 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef8" 50 45 51|4 52|CDS(Ac-lef8)_50 53|1 54|LEF8; 101765 kD primary translation product; putative DNA-dependant RNA-polymerase beta subunit 55|45999 56|48629 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef8"|/codon_start=1|/product="late expression factor 8"|/protein_id="AAA66680.1"|/db_xref="PID:g559119"|/db_xref="GI:559119" 50 45 51|60 52|AcOrf-51 53|0 55|48656 56|49612 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-51" 50 45 51|4 52|CDS(AcOrf-51)_51 53|0 54|37532 kD primary translation product 55|48656 56|49612 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-51"|/codon_start=1|/product="AcOrf-51 peptide"|/protein_id="AAA66681.1"|/db_xref="PID:g559120"|/db_xref="GI:559120" 50 45 51|60 52|AcOrf-52 53|1 55|49815 56|50186 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-52" 50 45 51|4 52|CDS(AcOrf-52)_52 53|1 54|14866 kD primary translation product 55|49815 56|50186 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-52"|/codon_start=1|/product="AcOrf-52 peptide"|/protein_id="AAA66682.1"|/db_xref="PID:g559121"|/db_xref="GI:559121" 50 45 51|60 52|AcOrf-53 53|0 55|50188 56|50607 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-53" 50 45 51|4 52|CDS(AcOrf-53)_53 53|0 54|16995 kD primary translation product 55|50188 56|50607 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-53"|/codon_start=1|/product="AcOrf-53 peptide"|/protein_id="AAA66683.1"|/db_xref="PID:g559122"|/db_xref="GI:559122" 50 45 51|60 52|Ac-lef10 53|0 54|AcOrf-53a 55|50604 56|50840 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef10" 50 45 51|4 52|CDS(Ac-lef10)_54 53|0 54|LEF10; 8596 kD primary translation product 55|50604 56|50840 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef10"|/codon_start=1|/product="late expression factor 10"|/protein_id="AAD18157.1"|/db_xref="PID:g4376187"|/db_xref="GI:4376187" 50 45 51|60 52|AcOrf-54 53|0 55|50698 56|51795 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-54" 50 45 51|4 52|CDS(AcOrf-54)_55 53|0 54|BmNPV vp1054; encodes 42094 kD primary translation product 55|50698 56|51795 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-54"|/codon_start=1|/product="viral capsid associated protein"|/protein_id="AAA66684.1"|/db_xref="PID:g559123"|/db_xref="GI:559123" 50 45 51|60 52|AcOrf-55 53|0 55|51887 56|52108 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-55" 50 45 51|4 52|CDS(AcOrf-55)_56 53|0 54|8190 kD primary translation product 55|51887 56|52108 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-55"|/codon_start=1|/product="AcOrf-55 peptide"|/protein_id="AAA66685.1"|/db_xref="PID:g559124"|/db_xref="GI:559124" 50 45 51|60 52|AcOrf-56 53|0 55|52110 56|52364 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-56" 50 45 51|4 52|CDS(AcOrf-56)_57 53|0 54|9858 kD primary translation product 55|52110 56|52364 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-56"|/codon_start=1|/product="AcOrf-56 peptide"|/protein_id="AAA66686.1"|/db_xref="PID:g559125"|/db_xref="GI:559125" 50 45 51|60 52|AcOrf-57 53|0 55|52549 56|53034 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-57" 50 45 51|4 52|CDS(AcOrf-57)_58 53|0 54|18994 kD primary translation product 55|52549 56|53034 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-57"|/codon_start=1|/product="AcOrf-57 peptide"|/protein_id="AAA66687.1"|/db_xref="PID:g559126"|/db_xref="GI:559126" 50 45 51|60 52|AcOrf-58 53|1 55|53050 56|53223 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-58" 50 45 51|4 52|CDS(AcOrf-58)_59 53|1 54|6816 kD primary translation product 55|53050 56|53223 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-58"|/codon_start=1|/product="AcOrf-58 peptide"|/protein_id="AAA66688.1"|/db_xref="PID:g559127"|/db_xref="GI:559127" 50 45 51|60 52|AcOrf-59 53|1 55|53358 56|53567 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-59" 50 45 51|4 52|CDS(AcOrf-59)_60 53|1 54|8174 kD primary translation product 55|53358 56|53567 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-59"|/codon_start=1|/product="AcOrf-59 peptide"|/protein_id="AAA66689.1"|/db_xref="PID:g559128"|/db_xref="GI:559128" 50 45 51|60 52|AcOrf-60 53|1 55|53579 56|53842 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-60" 50 45 51|4 52|CDS(AcOrf-60)_61 53|1 54|10148 kD primary translation product 55|53579 56|53842 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-60"|/codon_start=1|/product="AcOrf-60 peptide"|/protein_id="AAA66690.1"|/db_xref="PID:g559129"|/db_xref="GI:559129" 50 45 51|60 52|Ac-FP 53|1 54|AcOrf-61 55|53989 56|54633 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-FP" 50 45 51|4 52|CDS(Ac-FP)_62 53|1 54|FP; 25228 kD primary translation product 55|53989 56|54633 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-FP"|/codon_start=1|/product="FP protein"|/protein_id="AAA66691.1"|/db_xref="PID:g559130"|/db_xref="GI:559130" 50 45 51|34 52|hr2a 53|0 54|1 copy of 30 bp imperfect palindromic sequence; this hr is located within the FP ORF 55|54155 56|54184 57|0 281|1 282|1 283|1 284|1 286|/standard_name="hr2a"|/function="enhancer; replication origin"|/rpt_type=dispersed 50 45 51|60 52|Ac-lef9 53|0 54|AcOrf-62 55|54660 56|56210 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef9" 50 45 51|4 52|CDS(Ac-lef9)_63 53|0 54|LEF9; 59305 kD primary translation product; putative DNA-dependant RNA-polymerase beta' subunit 55|54660 56|56210 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef9"|/codon_start=1|/product="late expression factor 9"|/protein_id="AAA66692.1"|/db_xref="PID:g559131"|/db_xref="GI:559131" 50 45 51|60 52|AcOrf-63 53|0 55|56271 56|56738 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-63" 50 45 51|4 52|CDS(AcOrf-63)_64 53|0 54|18476 kD primary translation product 55|56271 56|56738 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-63"|/codon_start=1|/product="AcOrf-63 peptide"|/protein_id="AAA66693.1"|/db_xref="PID:g559132"|/db_xref="GI:559132" 50 45 51|60 52|Ac-gp37 53|1 54|AcOrf-64 55|56759 56|57667 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-gp37" 50 45 51|4 52|CDS(Ac-gp37)_65 53|1 54|gp37; 34798 kD primary translation product; 34.8K; SLP; spheroidin-like protein 55|56759 56|57667 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-gp37"|/codon_start=1|/product="fusolin; spindle body protein"|/protein_id="AAA66694.1"|/db_xref="PID:g559133"|/db_xref="GI:559133" 50 45 51|60 52|Ac-DNA-pol 53|1 54|AcOrf-65 55|57805 56|60759 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-DNA-pol" 50 45 51|4 52|CDS(Ac-DNA-pol)_66 53|1 54|DNA pol; 114307 kD primary translation product 55|57805 56|60759 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-DNA-pol"|/codon_start=1|/product="DNA-dependant DNA-polymerase"|/protein_id="AAA66695.1"|/db_xref="PID:g559134"|/db_xref="GI:559134" 50 45 51|60 52|AcOrf-66 53|0 55|60768 56|63194 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-66" 50 45 51|4 52|CDS(AcOrf-66)_67 53|0 54|93973 kD primary translation product 55|60768 56|63194 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-66"|/codon_start=1|/product="AcOrf-66 peptide"|/protein_id="AAA66696.1"|/db_xref="PID:g559135"|/db_xref="GI:559135" 50 45 51|60 52|Ac-lef3 53|1 54|AcOrf-67 55|63197 56|64354 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef3" 50 45 51|4 52|CDS(Ac-lef3)_68 53|1 54|LEF3; 44551 kD primary translation product 55|63197 56|64354 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef3"|/codon_start=1|/product="late expression factor 3"|/protein_id="AAA66697.1"|/db_xref="PID:g559136"|/db_xref="GI:559136" 50 45 51|60 52|AcOrf-68 53|0 55|64196 56|64774 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-68" 50 45 51|4 52|CDS(AcOrf-68)_69 53|0 54|22333 kD primary translation product 55|64196 56|64774 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-68"|/codon_start=1|/product="AcOrf-68 peptide"|/protein_id="AAA66698.1"|/db_xref="PID:g559137"|/db_xref="GI:559137" 50 45 51|60 52|AcOrf-69 53|0 55|64752 56|65540 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-69" 50 45 51|4 52|CDS(AcOrf-69)_70 53|0 54|30355 kD primary translation product; similarity to cell division proteins 55|64752 56|65540 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-69"|/codon_start=1|/product="putative methyl transferase"|/protein_id="AAA66699.1"|/db_xref="PID:g559138"|/db_xref="GI:559138" 50 45 51|60 52|AcOrf-70 53|0 55|65586 56|66458 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-70" 50 45 51|4 52|CDS(AcOrf-70)_71 53|0 54|34408 kD primary translation product 55|65586 56|66458 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-70"|/codon_start=1|/product="AcOrf-70 peptide"|/protein_id="AAA66700.1"|/db_xref="PID:g559139"|/db_xref="GI:559139" 50 45 51|60 52|Ac-IAP2 53|0 54|AcOrf-71 55|66492 56|67241 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IAP2" 50 45 51|4 52|CDS(Ac-IAP2)_72 53|0 54|IAP2; 28621 kD primary translation product 55|66492 56|67241 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IAP2"|/codon_start=1|/product="apoptosis inhibitor"|/protein_id="AAA66701.1"|/db_xref="PID:g559140"|/db_xref="GI:559140" 50 45 51|60 52|AcOrf-72 53|0 55|67300 56|67482 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-72" 50 45 51|4 52|CDS(AcOrf-72)_73 53|0 54|7068 kD primary translation product 55|67300 56|67482 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-72"|/codon_start=1|/product="AcOrf-72 peptide"|/protein_id="AAA66702.1"|/db_xref="PID:g559141"|/db_xref="GI:559141" 50 45 51|60 52|AcOrf-73 53|1 55|67491 56|67790 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-73" 50 45 51|4 52|CDS(AcOrf-73)_74 53|1 54|11526 kD primary translation product 55|67491 56|67790 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-73"|/codon_start=1|/product="AcOrf-73 peptide"|/protein_id="AAA66703.1"|/db_xref="PID:g559142"|/db_xref="GI:559142" 50 45 51|60 52|AcOrf-74 53|1 55|67787 56|68584 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-74" 50 45 51|4 52|CDS(AcOrf-74)_75 53|1 54|30567 kD primary translation product 55|67787 56|68584 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-74"|/codon_start=1|/product="AcOrf-74 peptide"|/protein_id="AAA66704.1"|/db_xref="PID:g559143"|/db_xref="GI:559143" 50 45 51|60 52|AcOrf-75 53|1 55|68602 56|69003 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-75" 50 45 51|4 52|CDS(AcOrf-75)_76 53|1 54|15512 kD primary translation product 55|68602 56|69003 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-75"|/codon_start=1|/product="AcOrf-75 peptide"|/protein_id="AAA66705.1"|/db_xref="PID:g559144"|/db_xref="GI:559144" 50 45 51|60 52|AcOrf-76 53|1 55|69019 56|69273 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-76" 50 45 51|4 52|CDS(AcOrf-76)_77 53|1 54|9440 kD primary translation product 55|69019 56|69273 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-76"|/codon_start=1|/product="AcOrf-76 peptide"|/protein_id="AAA66706.1"|/db_xref="PID:g559145"|/db_xref="GI:559145" 50 45 51|60 52|Ac-vlf-1 53|1 54|AcOrf-77 55|69289 56|70428 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-vlf-1" 50 45 51|4 52|CDS(Ac-vlf-1)_78 53|1 54|vlf-1; 44363 kD primary translation product 55|69289 56|70428 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-vlf-1"|/codon_start=1|/product="very late expression factor 1"|/protein_id="AAA66707.1"|/db_xref="PID:g559146"|/db_xref="GI:559146" 50 45 51|60 52|AcOrf-78 53|1 55|70434 56|70763 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-78" 50 45 51|4 52|CDS(AcOrf-78)_79 53|1 54|12545 kD primary translation product 55|70434 56|70763 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-78"|/codon_start=1|/product="AcOrf-78 peptide"|/protein_id="AAA66708.1"|/db_xref="PID:g559147"|/db_xref="GI:559147" 50 45 51|60 52|AcOrf-79 53|1 55|70766 56|71080 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-79" 50 45 51|4 52|CDS(AcOrf-79)_80 53|1 54|12199 kD primary translation product 55|70766 56|71080 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-79"|/codon_start=1|/product="AcOrf-79 peptide"|/protein_id="AAA66709.1"|/db_xref="PID:g559148"|/db_xref="GI:559148" 50 45 51|60 52|Ac-gp41 53|1 54|AcOrf-80 55|71083 56|72312 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-gp41" 50 45 51|4 52|CDS(Ac-gp41)_81 53|1 54|gp41; 45381 kD primary translation product 55|71083 56|72312 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-gp41"|/codon_start=1|/product="occlusion-derived virus glycoprotein"|/protein_id="AAA66710.1"|/db_xref="PID:g559149"|/db_xref="GI:559149" 50 45 51|60 52|AcOrf-81 53|1 55|72302 56|73003 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-81" 50 45 51|4 52|CDS(AcOrf-81)_82 53|1 54|26920 kD primary translation product 55|72302 56|73003 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-81"|/codon_start=1|/product="AcOrf-81 peptide"|/protein_id="AAA66711.1"|/db_xref="PID:g559150"|/db_xref="GI:559150" 50 45 51|60 52|Ac-TLP 53|1 54|AcOrf-82 55|72852 56|73394 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-TLP" 50 45 51|4 52|CDS(Ac-TLP)_83 53|1 54|(TLP20); 19752 kD primary translation product 55|72852 56|73394 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-TLP"|/codon_start=1|/product="telokin-like protein-20"|/protein_id="AAA66712.1"|/db_xref="PID:g559151"|/db_xref="GI:559151" 50 45 51|60 52|Ac-p95 53|0 54|AcOrf-83 55|73360 56|75903 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p95" 50 45 51|4 52|CDS(Ac-p95)_84 53|0 54|p95; 96209 kD primary translation product 55|73360 56|75903 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p95"|/codon_start=1|/product="viral capsid associated protein"|/protein_id="AAA66713.1"|/db_xref="PID:g559152"|/db_xref="GI:559152" 50 45 51|9 52|hr3 53|0 54|8 copies of 30 bp imperfect palindromic sequence 55|75944 56|76609 57|0 281|1 282|1 283|1 284|1 286|/standard_name="hr3"|/function="enhancer; replication origin"|/rpt_type=dispersed 50 45 51|60 52|AcOrf-84 53|0 55|76641 56|77207 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-84" 50 45 51|4 52|CDS(AcOrf-84)_85 53|0 54|21720 kD primary translation product 55|76641 56|77207 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-84"|/codon_start=1|/product="AcOrf-84 peptide"|/protein_id="AAA66714.1"|/db_xref="PID:g559153"|/db_xref="GI:559153" 50 45 51|60 52|AcOrf-85 53|0 55|77410 56|77571 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-85" 50 45 51|4 52|CDS(AcOrf-85)_86 53|0 54|6367 kD primary translation product 55|77410 56|77571 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-85"|/codon_start=1|/product="AcOrf-85 peptide"|/protein_id="AAA66715.1"|/db_xref="PID:g559154"|/db_xref="GI:559154" 50 45 51|60 52|Ac-PNK/PNL 53|1 54|AcOrf-86 55|77607 56|79691 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-PNK/PNL" 50 45 51|4 52|CDS(Ac-PNK/PNL)_87 53|1 54|PNK/PNL; 80759 kD primary translation product 55|77607 56|79691 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-PNK/PNL"|/codon_start=1|/product="polynucleotide kinase/ligase"|/protein_id="AAA66716.1"|/db_xref="PID:g559155"|/db_xref="GI:559155" 50 45 51|60 52|Ac-p15 53|0 54|AcOrf-87 55|79832 56|80212 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p15" 50 45 51|4 52|CDS(Ac-p15)_88 53|0 54|15K; putative viral capsid protein; encodes 15048 kD primary translation product 55|79832 56|80212 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p15"|/codon_start=1|/product="p15"|/protein_id="AAA66717.1"|/db_xref="PID:g559156"|/db_xref="GI:559156" 50 45 51|60 52|Ac-cg30 53|1 54|AcOrf-88 55|80213 56|81007 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-cg30" 50 45 51|4 52|CDS(Ac-cg30)_89 53|1 54|cg30; 30092 kD primary translation product 55|80213 56|81007 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-cg30"|/codon_start=1|/protein_id="AAA66718.1"|/db_xref="PID:g559157"|/db_xref="GI:559157" 50 45 51|60 52|Ac-vp39 53|1 54|AcOrf-89 55|81010 56|82053 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-vp39" 50 45 51|4 52|CDS(Ac-vp39)_90 53|1 54|capsid; 38951 kD primary translation product; vp39 55|81010 56|82053 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-vp39"|/codon_start=1|/product="major viral capsid protein"|/protein_id="AAA66719.1"|/db_xref="PID:g559158"|/db_xref="GI:559158" 50 45 51|60 52|Ac-lef4 53|0 54|AcOrf-90 55|82072 56|83466 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef4" 50 45 51|4 52|CDS(Ac-lef4)_91 53|0 54|LEF4; 53909 kD primary translation product 55|82072 56|83466 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef4"|/codon_start=1|/product="late expression factor 4"|/protein_id="AAA66720.1"|/db_xref="PID:g559159"|/db_xref="GI:559159" 50 45 51|60 52|AcOrf-91 53|1 55|83463 56|84137 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-91" 50 45 51|4 52|CDS(AcOrf-91)_92 53|1 54|24138 kD primary translation product 55|83463 56|84137 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-91"|/codon_start=1|/product="AcOrf-91 peptide"|/protein_id="AAA66721.1"|/db_xref="PID:g559160"|/db_xref="GI:559160" 50 45 51|60 52|AcOrf-92 53|1 55|84175 56|84954 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-92" 50 45 51|4 52|CDS(AcOrf-92)_93 53|1 54|OpNPV 33.3K; encodes 30937 kD primary translation product 55|84175 56|84954 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-92"|/codon_start=1|/product="AcOrf-92 peptide"|/protein_id="AAA66722.1"|/db_xref="PID:g559161"|/db_xref="GI:559161" 50 45 51|60 52|AcOrf-93 53|0 55|84953 56|85438 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-93" 50 45 51|4 52|CDS(AcOrf-93)_94 53|0 54|OpNPV 17.8K; encodes 18380 kD primary translation product 55|84953 56|85438 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-93"|/codon_start=1|/product="AcOrf-93 peptide"|/protein_id="AAA66723.1"|/db_xref="PID:g559162"|/db_xref="GI:559162" 50 45 51|60 52|Ac-odv-e25 53|0 54|AcOrf-94 55|85447 56|86133 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-e25" 50 45 51|4 52|CDS(Ac-odv-e25)_95 53|0 54|E25; OpNPV 25.5K; encodes 25526 kD primary translation product; p25 55|85447 56|86133 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-e25"|/codon_start=1|/product="occlusion-derived virus envelope protein"|/protein_id="AAA66724.1"|/db_xref="PID:g559163"|/db_xref="GI:559163" 50 45 51|60 52|Ac-helicase 53|1 54|AcOrf-95 55|86170 56|89835 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-helicase" 50 45 51|4 52|CDS(Ac-helicase)_96 53|1 54|p143; 143213 kD primary translation product 55|86170 56|89835 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-helicase"|/codon_start=1|/product="helicase"|/protein_id="AAA66725.1"|/db_xref="PID:g559164"|/db_xref="GI:559164" 50 45 51|60 52|AcOrf-96 53|0 55|89822 56|90343 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-96" 50 45 51|4 52|CDS(AcOrf-96)_97 53|0 54|19840 kD primary translation product 55|89822 56|90343 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-96"|/codon_start=1|/product="AcOrf-96 peptide"|/protein_id="AAA66726.1"|/db_xref="PID:g559165"|/db_xref="GI:559165" 50 45 51|60 52|AcOrf-97 53|0 55|90315 56|90485 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-97" 50 45 51|4 52|CDS(AcOrf-97)_98 53|0 54|6535 kD primary translation product 55|90315 56|90485 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-97"|/codon_start=1|/product="AcOrf-97 peptide"|/protein_id="AAA66727.1"|/db_xref="PID:g559166"|/db_xref="GI:559166" 50 45 51|60 52|Ac-38K 53|1 54|AcOrf-98 55|90497 56|91459 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-38K" 50 45 51|4 52|CDS(Ac-38K)_99 53|1 54|38K; 38021 kD primary translation product 55|90497 56|91459 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-38K"|/codon_start=1|/protein_id="AAA66728.1"|/db_xref="PID:g559167"|/db_xref="GI:559167" 50 45 51|60 52|Ac-lef5 53|0 54|AcOrf-99 55|91394 56|92191 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef5" 50 45 51|4 52|CDS(Ac-lef5)_100 53|0 54|LEF5; 31010 kD primary translation product 55|91394 56|92191 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef5"|/codon_start=1|/product="late expression factor 5"|/protein_id="AAA66729.1"|/db_xref="PID:g559168"|/db_xref="GI:559168" 50 45 51|60 52|Ac-p6.9 53|1 54|AcOrf-100 55|92188 56|92355 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p6.9" 50 45 51|4 52|CDS(Ac-p6.9)_101 53|1 54|p6.9; 6885 kD primary translation product; basic protein 55|92188 56|92355 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p6.9"|/codon_start=1|/product="major DNA binding protein"|/protein_id="AAA66730.1"|/db_xref="PID:g559169"|/db_xref="GI:559169" 50 45 51|60 52|Ac-p40 53|1 54|AcOrf-101 55|92397 56|93482 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p40" 50 45 51|4 52|CDS(Ac-p40)_102 53|1 54|p40; 41537 kD primary translation product 55|92397 56|93482 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p40"|/codon_start=1|/protein_id="AAA66731.1"|/db_xref="PID:g559170"|/db_xref="GI:559170" 50 45 51|60 52|AcOrf-102 53|1 55|93502 56|93870 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-102" 50 45 51|4 52|CDS(AcOrf-102)_103 53|1 54|13335 kD primary translation product 55|93502 56|93870 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-102"|/codon_start=1|/product="AcOrf-102"|/protein_id="AAA66732.1"|/db_xref="PID:g559171"|/db_xref="GI:559171" 50 45 51|60 52|Ac-p48 53|1 54|AcOrf-103 55|93851 56|95014 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p48" 50 45 51|4 52|CDS(Ac-p48)_104 53|1 54|p48; 45313 kD primary translation product 55|93851 56|95014 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p48"|/codon_start=1|/protein_id="AAA66733.1"|/db_xref="PID:g559172"|/db_xref="GI:559172" 50 45 51|60 52|Ac-vp80 53|0 54|AcOrf-104 55|95040 56|97115 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-vp80" 50 45 51|4 52|CDS(Ac-vp80)_105 53|0 54|vp80; 79878 kD primary translation product 55|95040 56|97115 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-vp80"|/codon_start=1|/product="viral capsid associated protein"|/protein_id="AAA66734.1"|/db_xref="PID:g559173"|/db_xref="GI:559173" 50 45 51|60 52|Ac-HE65 53|1 54|AcOrf-105 55|97143 56|98804 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-HE65" 50 45 51|4 52|CDS(Ac-HE65)_106 53|1 54|HE65; 65576 kD primary translation product; delayed early gene 55|97143 56|98804 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-HE65"|/codon_start=1|/protein_id="AAA66735.1"|/db_xref="PID:g559174"|/db_xref="GI:559174" 50 45 51|34 52|hr4a 53|0 54|2 copies of 30 bp imperfect palindromic sequence 55|98932 56|99081 57|0 281|1 282|1 283|1 284|1 286|/standard_name="hr4a"|/function="enhancer; replication origin"|/rpt_type=dispersed 50 45 51|60 52|AcOrf-106 53|0 55|99349 56|99534 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-106" 50 45 51|4 52|CDS(AcOrf-106)_107 53|0 54|7098 kD primary translation product 55|99349 56|99534 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-106"|/codon_start=1|/product="AcOrf-106 peptide"|/protein_id="AAA66736.1"|/db_xref="PID:g559175"|/db_xref="GI:559175" 50 45 51|60 52|AcOrf-107 53|0 55|99535 56|99867 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-107" 50 45 51|4 52|CDS(AcOrf-107)_108 53|0 54|12547 kD primary translation product 55|99535 56|99867 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-107"|/codon_start=1|/product="AcOrf-107 peptide"|/protein_id="AAA66737.1"|/db_xref="PID:g559176"|/db_xref="GI:559176" 50 45 51|60 52|AcOrf-108 53|1 55|99868 56|100185 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-108" 50 45 51|4 52|CDS(AcOrf-108)_109 53|1 54|11840 kD primary translation product 55|99868 56|100185 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-108"|/codon_start=1|/product="AcOrf-108 peptide"|/protein_id="AAA66738.1"|/db_xref="PID:g559177"|/db_xref="GI:559177" 50 45 51|60 52|AcOrf-109 53|1 55|100197 56|101369 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-109" 50 45 51|4 52|CDS(AcOrf-109)_110 53|1 54|44802 kD primary translation product 55|100197 56|101369 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-109"|/codon_start=1|/product="AcOrf-109 peptide"|/protein_id="AAA66739.1"|/db_xref="PID:g559178"|/db_xref="GI:559178" 50 45 51|60 52|AcOrf-110 53|1 55|101405 56|101575 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-110" 50 45 51|4 52|CDS(AcOrf-110)_111 53|1 54|6799 kD primary translation product 55|101405 56|101575 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-110"|/codon_start=1|/product="AcOrf-110 peptide"|/protein_id="AAA66740.1"|/db_xref="PID:g559179"|/db_xref="GI:559179" 50 45 51|60 52|AcOrf-111 53|1 55|101624 56|101827 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-111" 50 45 51|4 52|CDS(AcOrf-111)_112 53|1 54|8169 kD primary translation product 55|101624 56|101827 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-111"|/codon_start=1|/product="AcOrf-111 peptide"|/protein_id="AAA66741.1"|/db_xref="PID:g559180"|/db_xref="GI:559180" 50 45 51|60 52|AcOrf-112 53|0 55|101997 56|102260 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-112" 50 45 51|4 52|CDS(AcOrf-112)_113 53|0 54|10460 kD primary translation product 55|101997 56|102260 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-112"|/codon_start=1|/product="AcOrf-112 peptide"|/protein_id="AAA66742.1"|/db_xref="PID:g559181"|/db_xref="GI:559181" 50 45 51|60 52|AcOrf-113 53|0 55|102265 56|102774 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-113" 50 45 51|4 52|CDS(AcOrf-113)_114 53|0 54|20290 kD primary translation product 55|102265 56|102774 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-113"|/codon_start=1|/product="AcOrf-113 peptide"|/protein_id="AAA66743.1"|/db_xref="PID:g559182"|/db_xref="GI:559182" 50 45 51|34 52|hr4b 53|0 54|5 copies of 30 bp imperfect palindromic sequence 55|102872 56|103357 57|0 281|1 282|1 283|1 284|1 286|/standard_name="hr4b"|/function="enhancer; replication origin"|/rpt_type=dispersed 50 45 51|60 52|AcOrf-114 53|1 55|103362 56|104636 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-114" 50 45 51|4 52|CDS(AcOrf-114)_115 53|1 54|49292 kD primary translation product 55|103362 56|104636 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-114"|/codon_start=1|/product="AcOrf-114 peptide"|/protein_id="AAA66744.1"|/db_xref="PID:g559183"|/db_xref="GI:559183" 50 45 51|60 52|AcOrf-115 53|1 55|104658 56|105272 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-115" 50 45 51|4 52|CDS(AcOrf-115)_116 53|1 54|23019 kD primary translation product 55|104658 56|105272 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-115"|/codon_start=1|/product="AcOrf-115 peptide"|/protein_id="AAA66745.1"|/db_xref="PID:g559184"|/db_xref="GI:559184" 50 45 51|60 52|AcOrf-116 53|1 55|105280 56|105450 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-116" 50 45 51|4 52|CDS(AcOrf-116)_117 53|1 54|6425 kD primary translation product 55|105280 56|105450 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-116"|/codon_start=1|/product="AcOrf-116 peptide"|/protein_id="AAA66746.1"|/db_xref="PID:g559185"|/db_xref="GI:559185" 50 45 51|60 52|AcOrf-117 53|0 55|105386 56|105673 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-117" 50 45 51|4 52|CDS(AcOrf-117)_118 53|0 54|10992 kD primary translation product 55|105386 56|105673 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-117"|/codon_start=1|/product="AcOrf-117 peptide"|/protein_id="AAA66747.1"|/db_xref="PID:g559186"|/db_xref="GI:559186" 50 45 51|60 52|AcOrf-118 53|1 55|105707 56|106180 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-118" 50 45 51|4 52|CDS(AcOrf-118)_119 53|1 54|18709 kD primary translation product 55|105707 56|106180 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-118"|/codon_start=1|/product="AcOrf-118 peptide"|/protein_id="AAA66748.1"|/db_xref="PID:g559187"|/db_xref="GI:559187" 50 45 51|60 52|AcOrf-119 53|0 55|106175 56|107767 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-119" 50 45 51|4 52|CDS(AcOrf-119)_120 53|0 54|59739 kD primary translation product 55|106175 56|107767 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-119"|/codon_start=1|/product="AcOrf-119 peptide"|/protein_id="AAA66749.1"|/db_xref="PID:g559188"|/db_xref="GI:559188" 50 45 51|60 52|AcOrf-120 53|0 55|107772 56|108020 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-120" 50 45 51|4 52|CDS(AcOrf-120)_121 53|0 54|9532 kD primary translation product 55|107772 56|108020 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-120"|/codon_start=1|/product="AcOrf-120 peptide"|/protein_id="AAA66750.1"|/db_xref="PID:g559189"|/db_xref="GI:559189" 50 45 51|34 52|hr4c 53|0 54|1 copy of 30 bp imperfect palindromic sequence 55|108082 56|108111 57|0 281|1 282|1 283|1 284|1 286|/standard_name="hr4c"|/function="enhancer; replication origin"|/rpt_type=dispersed 50 45 51|60 52|AcOrf-121 53|0 55|108123 56|108299 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-121" 50 45 51|4 52|CDS(AcOrf-121)_122 53|0 54|6705 kD primary translation product 55|108123 56|108299 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-121"|/codon_start=1|/product="AcOrf-121 peptide"|/protein_id="AAA66751.1"|/db_xref="PID:g559190"|/db_xref="GI:559190" 50 45 51|60 52|AcOrf-122 53|1 55|108189 56|108377 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-122" 50 45 51|4 52|CDS(AcOrf-122)_123 53|1 54|7216 kD primary translation product 55|108189 56|108377 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-122"|/codon_start=1|/product="AcOrf-122 peptide"|/protein_id="AAA66752.1"|/db_xref="PID:g559191"|/db_xref="GI:559191" 50 45 51|60 52|Ac-pk-2 53|1 54|AcOrf-123 55|108440 56|109087 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-pk-2" 50 45 51|4 52|CDS(Ac-pk-2)_124 53|1 54|PK2; 24944 kD primary translation product 55|108440 56|109087 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-pk-2"|/codon_start=1|/product="protein kinase"|/protein_id="AAA66753.1"|/db_xref="PID:g559192"|/db_xref="GI:559192" 50 45 51|60 52|AcOrf-124 53|0 55|109269 56|110012 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-124" 50 45 51|4 52|CDS(AcOrf-124)_125 53|0 54|28530 kD primary translation product 55|109269 56|110012 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-124"|/codon_start=1|/product="AcOrf-124 peptide"|/protein_id="AAA66754.1"|/db_xref="PID:g559193"|/db_xref="GI:559193" 50 45 51|60 52|Ac-lef7 53|1 54|AcOrf-125 55|110029 56|110709 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef7" 50 45 51|4 52|CDS(Ac-lef7)_126 53|1 54|LEF7; 26612 kD primary translation product 55|110029 56|110709 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-lef7"|/codon_start=1|/product="late expression factor 7"|/protein_id="AAA66755.1"|/db_xref="PID:g559194"|/db_xref="GI:559194" 50 45 51|60 52|Ac-chitinase 53|1 54|AcOrf-126 55|110758 56|112413 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-chitinase" 50 45 51|4 52|CDS(Ac-chitinase)_127 53|1 54|61368 kD primary translation product 55|110758 56|112413 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-chitinase"|/codon_start=1|/product="chitinase"|/protein_id="AAA66756.1"|/db_xref="PID:g559195"|/db_xref="GI:559195" 50 45 51|60 52|Ac-v-cath 53|0 54|AcOrf-127 55|112459 56|113430 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-v-cath" 50 45 51|4 52|CDS(Ac-v-cath)_128 53|0 54|v-cath; 36938 kD primary translation product 55|112459 56|113430 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-v-cath"|/codon_start=1|/product="viral cathepsin-like protein"|/protein_id="AAA66757.1"|/db_xref="PID:g559196"|/db_xref="GI:559196" 50 45 51|60 52|Ac-gp64 53|1 54|AcOrf-128 55|113655 56|115193 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-gp64" 50 45 51|4 52|CDS(Ac-gp64)_129 53|1 54|gp67; 58566 kD primary translation product; the upstream, in-frame, initiation codon at 109769..109771 is not used 55|113655 56|115193 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-gp64"|/codon_start=1|/product="major budded virus envelope glycoprotein"|/protein_id="AAA66758.2"|/db_xref="PID:g4376188"|/db_xref="GI:4376188" 50 45 51|60 52|Ac-p24 53|0 54|AcOrf-129 55|115376 56|115972 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p24" 50 45 51|4 52|CDS(Ac-p24)_130 53|0 54|p24; 22110 kD primary translation product 55|115376 56|115972 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p24"|/codon_start=1|/product="viral capsid protein"|/protein_id="AAA66759.1"|/db_xref="PID:g559198"|/db_xref="GI:559198" 50 45 51|60 52|Ac-gp16 53|0 54|AcOrf-130 55|116000 56|116320 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-gp16" 50 45 51|4 52|CDS(Ac-gp16)_131 53|0 54|gp16; 12112 kD primary translation product 55|116000 56|116320 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-gp16"|/codon_start=1|/protein_id="AAA66760.1"|/db_xref="PID:g559199"|/db_xref="GI:559199" 50 45 51|60 52|Ac-PE/pp34 53|0 54|AcOrf-131 55|116379 56|117137 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-PE/pp34" 50 45 51|4 52|CDS(Ac-PE/pp34)_132 53|0 54|pp34; 29079 kD primary translation product 55|116379 56|117137 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-PE/pp34"|/codon_start=1|/product="major polyhedral calyx protein"|/protein_id="AAA66761.1"|/db_xref="PID:g559200"|/db_xref="GI:559200" 50 45 51|60 52|AcOrf-132 53|0 55|117349 56|118008 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-132" 50 45 51|4 52|CDS(AcOrf-132)_133 53|0 54|25136 kD primary translation product 55|117349 56|118008 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-132"|/codon_start=1|/product="AcOrf-132 peptide"|/protein_id="AAA66762.1"|/db_xref="PID:g559201"|/db_xref="GI:559201" 50 45 51|60 52|Ac-alk-exo 53|0 54|AcOrf-133 55|118036 56|119295 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-alk-exo" 50 45 51|4 52|CDS(Ac-alk-exo)_134 53|0 54|alk-exo; 48291 kD primary translation product 55|118036 56|119295 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-alk-exo"|/codon_start=1|/product="alkaline exonuclease"|/protein_id="AAA66763.1"|/db_xref="PID:g559202"|/db_xref="GI:559202" 50 45 51|60 52|Ac-94K 53|1 54|AcOrf-134 55|119346 56|121757 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-94K" 50 45 51|4 52|CDS(Ac-94K)_135 53|1 54|94K; 94540 kD primary translation product 55|119346 56|121757 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-94K"|/codon_start=1|/protein_id="AAA66764.1"|/db_xref="PID:g559203"|/db_xref="GI:559203" 50 45 51|60 52|Ac-35K/p35 53|0 54|AcOrf-135 55|121968 56|122867 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-35K/p35" 50 45 51|4 52|CDS(Ac-35K/p35)_136 53|0 54|35K; 34828 kD primary translation product; annihilator 55|121968 56|122867 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-35K/p35"|/codon_start=1|/product="apoptosis inhibitor"|/protein_id="AAA66765.1"|/db_xref="PID:g559204"|/db_xref="GI:559204" 50 45 51|34 52|hr5 53|0 54|6 copies of 30 bp imperfect palindromic sequence 55|122955 56|123463 57|0 281|1 282|1 283|1 284|1 286|/standard_name="hr5"|/function="enhancer; replication origin"|/rpt_type=dispersed 50 45 51|60 52|Ac-p26 53|0 54|AcOrf-136 55|123520 56|124242 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p26" 50 45 51|4 52|CDS(Ac-p26)_137 53|0 54|p26; 27282 kD primary translation product 55|123520 56|124242 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p26"|/codon_start=1|/protein_id="AAA66766.1"|/db_xref="PID:g559205"|/db_xref="GI:559205" 50 45 51|60 52|Ac-p10 53|0 54|AcOrf-137 55|124315 56|124599 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p10" 50 45 51|4 52|CDS(Ac-p10)_138 53|0 54|p10; 10310 kD primary translation product 55|124315 56|124599 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p10"|/codon_start=1|/product="fibrous body protein"|/protein_id="AAA66767.1"|/db_xref="PID:g559206"|/db_xref="GI:559206" 50 45 51|60 52|Ac-p74 53|1 54|AcOrf-138 55|124611 56|126548 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p74" 50 45 51|4 52|CDS(Ac-p74)_139 53|1 54|p74; 73885 kD primary translation product; required for in vivo virulence of occluded virus 55|124611 56|126548 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-p74"|/codon_start=1|/product="occlusion-derived virus envelope protein"|/protein_id="AAA66768.1"|/db_xref="PID:g559207"|/db_xref="GI:559207" 50 45 51|60 52|Ac-ME53 53|1 54|AcOrf-139 55|126681 56|128030 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-ME53" 50 45 51|4 52|CDS(Ac-ME53)_140 53|1 54|ME53; 52636 kD primary translation product; immediate early gene 55|126681 56|128030 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-ME53"|/codon_start=1|/product="DNA synthesis regulator"|/protein_id="AAA66769.1"|/db_xref="PID:g559208"|/db_xref="GI:559208" 50 45 51|60 52|AcOrf-140 53|0 55|128101 56|128283 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-140" 50 45 51|4 52|CDS(AcOrf-140)_141 53|0 54|7096 kD primary translation product 55|128101 56|128283 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-140"|/codon_start=1|/product="AcOrf-140 peptide"|/protein_id="AAA66770.1"|/db_xref="PID:g559209"|/db_xref="GI:559209" 50 45 51|60 52|Ac-IE-01 53|0 54|AcOrf-141a 55|128308 56|134422 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IE-01" 50 45 51|60 52|Ac-IE-0 53|0 54|AcOrf-141 55|128308 56|129093 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IE-0" 50 45 51|4 52|CDS(Ac-IE-01)_142 53|0 54|IE-01; 72609 kD primary translation product 55|128308 56|134422 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IE-01"|/codon_start=1|/product="putative early gene transactivator"|/protein_id="AAD18158.1"|/db_xref="PID:g4376189"|/db_xref="GI:4376189" 287 288|0 289|113 290 287 288|4318 289|1796 290 50 45 51|4 52|CDS(Ac-IE-0)_143 53|0 54|IE-0; 30109 kD primary translation product 55|128308 56|129093 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IE-0"|/codon_start=1|/protein_id="AAA66771.1"|/db_xref="PID:g559210"|/db_xref="GI:559210" 50 45 51|60 52|Ac-49K 53|0 54|AcOrf-142 55|129108 56|130541 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-49K" 50 45 51|4 52|CDS(Ac-49K)_144 53|0 54|49K; 55417 kD primary translation product; early gene; similarity to juvenile hormone sensitive hemolymph protein 55|129108 56|130541 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-49K"|/codon_start=1|/product="early 49 kDa protein"|/protein_id="AAA66772.1"|/db_xref="PID:g559211"|/db_xref="GI:559211" 50 45 51|60 52|Ac-odv-e18 53|0 54|AcOrf-143 55|130629 56|130817 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-e18" 50 45 51|4 52|CDS(Ac-odv-e18)_145 53|0 54|E18; 6559 kD primary translation product; N-terminus of odv-e35 55|130629 56|130817 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-e18"|/codon_start=1|/product="occlusion-derived virus envelope protein"|/protein_id="AAA66773.1"|/db_xref="PID:g559212"|/db_xref="GI:559212" 50 45 51|60 52|Ac-odv-ec27 53|0 54|AcOrf-144 55|130833 56|131705 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-ec27" 50 45 51|4 52|CDS(Ac-odv-ec27)_146 53|0 54|EC27; 33528 kD primary translation product 55|130833 56|131705 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-ec27"|/codon_start=1|/product="occlusion-derived virus envelope/capsid protein"|/protein_id="AAA66774.1"|/db_xref="PID:g559213"|/db_xref="GI:559213" 50 45 51|60 52|AcOrf-145 53|0 55|131775 56|132008 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-145" 50 45 51|4 52|CDS(AcOrf-145)_147 53|0 54|8850 kD primary translation product 55|131775 56|132008 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-145"|/codon_start=1|/product="AcOrf-145 peptide"|/protein_id="AAA66775.1"|/db_xref="PID:g559214"|/db_xref="GI:559214" 50 45 51|60 52|AcOrf-146 53|1 55|132003 56|132608 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-146" 50 45 51|4 52|CDS(AcOrf-146)_148 53|1 54|22881 kD primary translation product 55|132003 56|132608 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-146"|/codon_start=1|/product="AcOrf-146 peptide"|/protein_id="AAA66776.1"|/db_xref="PID:g559215"|/db_xref="GI:559215" 50 45 51|60 52|Ac-IE-1 53|0 54|AcOrf-147 55|132674 56|134422 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IE-1" 50 45 51|4 52|CDS(Ac-IE-1)_149 53|0 54|IE-1; 66881 kD primary translation product 55|132674 56|134422 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IE-1"|/codon_start=1|/product="early gene transactivator"|/protein_id="AAA66777.1"|/db_xref="PID:g559216"|/db_xref="GI:559216" 50 45 51|60 52|Ac-odv-e56 53|1 54|AcOrf-148 55|134484 56|135614 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-e56" 50 45 51|4 52|CDS(Ac-odv-e56)_150 53|1 54|E56; 40863 kD primary translation product 55|134484 56|135614 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-odv-e56"|/codon_start=1|/product="occlusion-derived virus envelope protein"|/protein_id="AAA66778.1"|/db_xref="PID:g559217"|/db_xref="GI:559217" 50 45 51|60 52|AcOrf-149 53|1 55|135643 56|135966 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-149" 50 45 51|4 52|CDS(AcOrf-149)_151 53|1 54|12419 kD primary translation product 55|135643 56|135966 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-149"|/codon_start=1|/product="AcOrf-149 peptide"|/protein_id="AAA66779.1"|/db_xref="PID:g559218"|/db_xref="GI:559218" 50 45 51|60 52|AcOrf-150 53|0 55|135932 56|136231 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-150" 50 45 51|4 52|CDS(AcOrf-150)_152 53|0 54|11161 kD primary translation product 55|135932 56|136231 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-150"|/codon_start=1|/product="AcOrf-150 peptide"|/protein_id="AAA66780.1"|/db_xref="PID:g559219"|/db_xref="GI:559219" 50 45 51|60 52|Ac-IE-2 53|1 54|AcOrf-151 55|136333 56|137559 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IE-2" 50 45 51|4 52|CDS(Ac-IE-2)_153 53|1 54|IE-2; 47007 kD primary translation product 55|136333 56|137559 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-IE-2"|/codon_start=1|/product="early gene transactivator"|/protein_id="AAA66781.1"|/db_xref="PID:g559220"|/db_xref="GI:559220" 50 45 51|60 52|AcOrf-152 53|1 55|137585 56|137863 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-152" 50 45 51|4 52|CDS(AcOrf-152)_154 53|1 54|10829 kD primary translation product 55|137585 56|137863 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-152"|/codon_start=1|/product="AcOrf-152 peptide"|/protein_id="AAA66782.1"|/db_xref="PID:g559221"|/db_xref="GI:559221" 50 45 51|60 52|Ac-PE38 53|0 54|AcOrf-153 55|138002 56|138967 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-PE38" 50 45 51|4 52|CDS(Ac-PE38)_155 53|0 54|PE38; 37425 kD primary translation product; immediate early gene 55|138002 56|138967 57|0 281|1 282|1 283|1 284|1 286|/gene="Ac-PE38"|/codon_start=1|/protein_id="AAA66783.1"|/db_xref="PID:g559222"|/db_xref="GI:559222" 50 45 51|60 52|AcOrf-154 53|0 55|139067 56|139312 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-154" 50 45 51|4 52|CDS(AcOrf-154)_156 53|0 54|9421 kD primary translation product 55|139067 56|139312 57|0 281|1 282|1 283|1 284|1 286|/gene="AcOrf-154"|/codon_start=1|/product="AcOrf-154 peptide"|/protein_id="AAA66784.1"|/db_xref="PID:g559223"|/db_xref="GI:559223" 50 45 51|34 52|hr1 53|0 54|5 copies of 30 bp imperfect palindromic sequence; the EcoRI site in the first palindrome is at residue 1 of the linearized genome 55|0 56|0 57|0 281|1 282|0 283|1 284|1 286|/standard_name="hr1"|/function="enhancer; replication origin"|/rpt_type=dispersed 50 45 51|29 52|PH promoter 53|0 55|4428 56|4556 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2260000" 50 45 51|4 52|6xHis 53|0 55|10140 56|10157 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1010000" 50 45 51|27 52|V5 reverse primer 53|0 55|10098 56|10118 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|27 52|Polyhedrin forward primer 53|0 55|4444 56|4461 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2060000" 50 45 51|21 52|boundary between His tag and native baculovirus 53|0 55|10169 56|10169 57|0 281|1 282|1 283|1 284|1 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gaattctacccgtaaagcgagtttagttttgaaaaacaaatgacatcatttgtataatgacatcatcccctgattgtgttttacaagtagaattctatccgtaaagcgagttcagttttgaaaacaaatgagtcatacctaaacacgttaataatcttctgatatcagcttatgactcaagttatgagccgtgtgcaaaacatgagataagtttatgacatcatccactgatcgtgcgttacaagtagaattctactcgtaaagccagttcggttatgagccgtgtgcaaaacatgacatcagcttatgactcatacttgattgtgttttacgcgtagaattctactcgtaaagcgagttcggttatgagccgtgtgcaaaacatgacatcagcttatgagtcataattaatcgtgcgttacaagtagaattctactcgtaaagcgagttgaaggatcatatttagttgcgtttatgagataagattgaaagcacgtgtaaaatgtttcccgcgcgttggcacaactatttacaatgcggccaagttataaaagattctaatctgatatgttttaaaacacctttgcggcccgagttgtttgcgtacgtgactagcgaagaagatgtgtggaccgcagaacagatagtaaaacaaaaccctagtattggagcaataatcgatttaaccaacacgtctaaatattatgatggtgtgcattttttgcgggcgggcctgttatacaaaaaaattcaagtacctggccagactttgccgcctgaaagcatagttcaagaatttattgacacggtaaaagaatttacagaaaagtgtcccggcatgttggtgggcgtgcactgcacacacggtattaatcgcaccggttacatggtgtgcagatatttaatgcacaccctgggtattgcgccgcaggaagccatagatagattcgaaaaagccagaggtcacaaaattgaaagacaaaattacgttcaagatttattaatttaattaatattatttgcattctttaacaaatactttatcctattttcaaattgttgcgcttcttccagcgaaccaaaactatgcttcgcttgctccgtttagcttgtagccgatcagtggcgttgttccaatcgacggtaggattaggccggatattctccaccacaatgttggcaacgttgatgttacgtttatgcttttggttttccacgtacgtcttttggccggtaatagccgtaaacgtagtgccgtcgcgcgtcacgcacaacaccggatgtttgcgcttgtccgcggggtattgaaccgcgcgatccgacaaatccaccactttggcaactaaatcggtgacctgcgcgtcttttttctgcattatttcgtctttcttttgcatggt 209|ttcctggaagccggtgtacatgcggtttagatcagtcatgacgcgcgtgacctgcaaatctttggcctcgatctgcttgtccttgatggcaacgatgcgttcaataaactcttgttttttaacaagttcctcggttttttgcgccaccaccgcttgcagcgcgtttgtgtgctcggtgaatgtcgcaatcagcttagtcaccaactgtttgctctcctcctcccgttgtttgatcgcgggatcgtacttgccggtgcagagcacttgaggaattacttcttctaaaagccattcttgtaattctatggcgtaaggcaatttggacttcataatcagctgaatcacgccggatttagtaatgagcactgtatgcggctgcaaatacagcgggtcgccccttttcacgacgctgttagaggtagggcccccattttggatggtctgctcaaataacgatttgtatttattgtctacatgaacacgtatagctttatcacaaactgtatattttaaactgttagcgacgtccttggccacgaaccggacctgttggtcgcgctctagcacgtaccgcaggttgaacgtatcttctccaaatttaaattctccaattttaacgcgagccattttgatacacgtgtgtcgattttgcaacaactattgttttttaacgcaaactaaacttattgtggtaagcaataattaaatatgggggaacatgcgccgctacaacactcgtcgttatgaacgcagacggcgccggtctcggcgcaagcggctaaaacgtgttgcgcgttcaacgcggcaaacatcgcaaaagccaatagtacagttttgatttgcatattaacggcgattttttaaattatcttatttaataaatagttatgacgcctacaactccccgcccgcgttgactcgctgcacctcgagcagttcgttgacgccttcctccgtgtggccgaacacgtcgagcgggtggtcgatgaccagcggcgtgccgcacgcgacgcacaagtatctgtacaccgaatgatcgtcgggcgaaggcacgtcggcctccaagtggcaatattggcaaattcgaaaatatatacagttgggttgtttgcgcatatctatcgtggcgttgggcatgtacgtccgaacgttgatttgcatgcaagccgaaattaaatcattgcgattagtgcgattaaaacgttgtacatcctcgcttttaatcatgccgtcgattaaatcgcgcaatcgagtcaagtgatcaaagtgtggaataatgttttctttgtattcccgagtcaagcgcagcgcgtattttaacaaactagccatcttgtaagttagtttcatttaatgcaactttatccaataatatattatgtatcgcacgtcaagaatta 209|acaatgcgcccgttgtcgcatctcaacacgactatgatagagatcaaataaagcgcgaattaaatagcttgcgacgcaacgtgcacgatctgtgcacgcgttccggcacgagctttgattgtaataagtttttacgaagcgatgacatgacccccgtagtgacaacgatcacgcccaaaagaactgccgactacaaaattaccgagtatgtcggtgacgttaaaactattaagccatccaatcgaccgttagtcgaatcaggaccgctggtgcgagaagccgcgaagtatggcgaatgcatcgtataacgtgtggagtccgctcattagagcgtcatgtttagacaagaaagctacatatttaattgatcccgatgattttattgataaattgaccctaactccatacacggtattctacaatggcggggttttggtcaaaatttccggactgcgattgtacatgctgttaacggctccgcccactattaatgaaattaaaaattccaattttaaaaaacgcagcaagagaaacatttgtatgaaagaatgcgtagaaggaaagaaaaatgtcgtcgacatgctgaacaacaagattaatatgcctccgtgtataaaaaaaatattgaacgatttgaaagaaaacaatgtaccgcgcggcggtatgtacaggaagaggtttatactaaactgttacattgcaaacgtggtttcgtgtgccaagtgtgaaaaccgatgtttaatcaaggctctgacgcatttctacaaccacgactccaagtgtgtgggtgaagtcatgcatcttttaatcaaatcccaagatgtgtataaaccaccaaactgccaaaaaatgaaaactgtcgacaagctctgtccgtttgctggcaactgcaagggtctcaatcctatttgtaattattgaataataaaacaattataaatgctaaatttgttttttattaacgatacaaaccaaacgcaacaagaacatttgtagtattatctataattgaaaacgcgtagttataatcgctgaggtaatatttaaaatcattttcaaatgattcacagttaatttgcgacaatataattttattttcacataaactagacgccttgtcgtcttcttcttcgtattccttctctttttcatttttctcctcataaaaattaacatagttattatcgtatccatatatgtatctatcgtatagagtaaattttttgttgtcataaatatatatgtcttttttaatggggtgtatagtaccgctgcgcatagtttttctgtaatttacaacagtgctattttctggtagttcttcggagtgtgttgctttaattattaaatttatataatcaatgaatttgggatcgtcggttttgtacaatatgttgccg 209|gcatagtacgcagcttcttctagttcaattacaccattttttagcagcaccggattaacataactttccaaaatgttgtacgaaccgttaaacaaaaacagttcacctcccttttctatactattgtctgcgagcagttgtttgttgttaaaaataacagccattgtaatgagacgcacaaactaatatcacaaactggaaatgtctatcaatatatagttgctgatatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggcgcggatccccgggtaccgatatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgctccctaacccacggggcccgtggctatggcagggcttgccgccccgacgttggctgcgagccctgggccttcacccgaacttgggggttggggtggggaaaaggaagaaacgcgggcgtattggtcccaatggggtctcggtggggtatcgacagagtgccagccctgggaccgaaccccgcgtttatgaacaaacgacccaacacccgtgcgttttattctgtctttttattgccgtcatagcgcgggttccttccggtattgtctccttccgtgtttcagttagcctcccccatctcccgggcaaacgtgcgcgccaggtcgcagatcgtcggtatggagcctggggtggtgacgtgggtctggaccatcccggaggtaagttgcagcagggcgtcccggcagccggcgggcgattggtcgtaatccaggataaagacatgcatgggacggaggcgtttggccaagacgtccaaagcccaggcaaacacgttatacaggtcgccgttgggggccagcaactcgggggcccgaaacagggtaaataacgtgtccccgatatggggtcgtgggcccgcgttgctctggggctcggcaccctggggcggcacggccgcccccgaaagctgtccccaatcctcccgccacgacccgccgccctgcagataccgcaccgtattggcaagcagcccataaacgcggcgaatcgcggccagcatagccaggtcaagccgctcgccggggcgctggcgtttggccaggcggtcgatgtgtctgtcctccggaagggcccccaacacgatgtttgtgccgggcaaggtcggcgggatgagggccacgaacgccagcacggcctggggggtcatgctgcccataaggtatcgcgcggcc 209|gggtagcacaggagggcggcgatgggatggcggtcgaagatgagggtgagggccgggggcggggcatgtgagctcccagcctcccccccgatatgaggagccagaacggcgtcggtcacggcataaggcatgcccattgttatctgggcgcttgtcattaccaccgccgcgtccccggccgatatctcaccctggtcgaggcggtgttgtgtggtgtagatgttcgcgattgtctcggaagcccccaacacccgccagtaagtcatcggctcgggtacgtagacgatatcgtcgcgcgaacccagggccaccagcagttgcgtggtggtggttttccccatcccgtggggaccgtctatataaacccgcagtagcgtgggcattttctgctccaggcggacttccgtggctttttgttgccggcgagggcgcaacgccgtacgtcggttgttatggccgcgagaacgcgcagcctggtcgaacgcagacgcgtgttgatggcaggggtacgaagccatagatcccgttatcaattacttatactatccggcgcgcaagcgagcgtgtgcgccggagcacaattgatactgatttacgagttgggcaaacgggctttatatagcctgtcccctccacagccctagtgccgtgcgcaaagtgcctacgtgaccaggctctcctacgcatatacaatcttatctctatagataaggtttccatatataaagcctctcgatggctgaacgtgcacagtatcgtgttgatttctgagtgctaactaacagttacaatgaaccgtttttttcgagagaataacatttttgacgcgccaaggaccgggggcaagggtcgtgccaaatctttgccagcgcctgccgccaactcgccgccgtcgcctgttcgtccgccgccaaaatctaacatcaaaccacctacgcgcatctctccgcctaaacagcctatgtgcacctctccggccaagccgttggagcacagcagcattgtaagtaaaaaaccagtcgtcaacagaaaagatggatattttgtgccgcccgagtttgggaacaagtttgaaggtttgcccgcgtacagcgacaaactggatttcaaacaagagcgcgatctacgtacctgcaggcccgggctcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaattcactctagaatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttc 209|ccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctacaccaacgtaacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgttggagtgacggcagttatctggaagatcaggatatgtggcggatgagcggcattttccgtgacgtctcgttgctgcataaaccgactacacaaatcagcgatttccatgttgccactcgctttaatgatgatttcagccgcgctgtactggaggctgaagttcagatgtgcggcgagttgcgtgactacctacgggtaacagtttctttatggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaattatcgatgagcgtggtggttatgccgatcgcgtcacactacgtctgaacgtcgaaaacccgaaactgtggagcgccgaaatcccgaatctctatcgtgcggtggttgaactgcacaccgccgacggcacgctgattgaagcagaagcctgcgatgtcggtttccgcgaggtgcggattgaaaatggtctgctgctgctgaacggcaagccgttgctgattcgaggcgttaaccgtcacgagcatcatcctctgcatggtcaggtcatggatgagcagacgatggtgcaggatatcctgctgatgaagcagaacaactttaacgccgtgcgctgttcgcattatccgaaccatccgctgtggtacacgctgtgcgaccgctacggcctgtatgtggtggatgaagccaatattgaaacccacggcatggtgccaatgaatcgtctgaccgatgatccgcgctggctaccggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctggggaatgaatcaggccacggcgctaatcacgacgcgctgtatcgctggatcaaatctgtcgatccttcccgcccggtgcagtatgaaggcggcggagccgacaccacggccaccgatattatttgcccgatgtacgcgcgcgtggatgaagaccagcccttcccggctg 209|tgccgaaatggtccatcaaaaaatggctttcgctacctggagagacgcgcccgctgatcctttgcgaatacgcccacgcgatgggtaacagtcttggcggtttcgctaaatactggcaggcgtttcgtcagtatccccgtttacagggcggcttcgtctgggactgggtggatcagtcgctgattaaatatgatgaaaacggcaacccgtggtcggcttacggcggtgattttggcgatacgccgaacgatcgccagttctgtatgaacggtctggtctttgccgaccgcacgccgcatccagcgctgacggaagcaaaacaccagcagcagtttttccagttccgtttatccgggcaaaccatcgaagtgaccagcgaatacctgttccgtcatagcgataacgagctcctgcactggatggtggcgctggatggtaagccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggtaaacagttgattgaactgcctgaactaccgcagccggagagcgccgggcaactctggctcacagtacgcgtagtgcaaccgaacgcgaccgcatggtcagaagccgggcacatcagcgcctggcagcagtggcgtctggcggaaaacctcagtgtgacgctccccgccgcgtcccacgccatcccgcatctgaccaccagcgaaatggatttttgcatcgagctgggtaataagcgttggcaatttaaccgccagtcaggctttctttcacagatgtggattggcgataaaaaacaactgctgacgccgctgcgcgatcagttcacccgtgcaccgctggataacgacattggcgtaagtgaagcgacccgcattgaccctaacgcctgggtcgaacgctggaaggcggcgggccattaccaggccgaagcagcgttgttgcagtgcacggcagatacacttgctgatgcggtgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttatttatcagccggaaaacctaccggattgatggtagtggtcaaatggcgattaccgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcctgaactgccagctggcgcaggtagcagagcgggtaaactggctcggattagggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcgaaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaactgatggaaaccagccatcgccatctgctgcacgcggaagaaggc 209|acatggctgaatatcgacggtttccatatggggattggtggcgacgactcctggagcccgtcagtatcggcggaattccagctgagcgccggtcgctaccattaccagttggtctggtgtcaaaaataatgactgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgagaatgaatgaagatctggggaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgaagatctgatcctttcctgggacccggcaagaaccaaaaactcactctcttcaaggaaatccgtaatgttaaacccgacacgatgaagcttgtcgttggatggaaaggaaaagagttctacagggaaacttggacccgcttcatggaagacagcttccccattgttaacgaccaagaagtgatggatgttttccttgttgtcaacatgcgtcccactagacccaaccgttgttacaaattcctggcccaacacgctctgcgttgcgaccccgactatgtacctcatgacgtgattaggatcgtcgagccttcatgggtgggcagcaacaacgagtaccgcatcagcctggctaagaagggcggcggctgcccaataatgaaccttcactctgagtacaccaactcgttcgaacagttcatcgatcgtgtcatctgggagaacttctacaagcccatcgtttacatcggtaccgactctgctgaagaggaggaaattctccttgaagtttccctggtgttcaaagtaaaggagtttgcaccagacgcacctctgttcactggtccggcgtattaaaacacgatacattgttattagtacatttattaagcgctagattctgtgcgttgttgatttacagacaattgttgtacgtattttaataattcattaaatttataatctttagggtggtatgttagagcgaaaatcaaatgattttcagcgtctttatatctgaatttaaatattaaatcctcaatagatttgtaaaataggtttcgattagtttcaaacaagggttgtttttccgaaccgatggctggactatctaatggattttcgctcaacgccacaaaacttgccaaatcttgtagcagcaatctagctttgtcgatattcgtttgtgttttgttttgtaataaaggttcgacgtcgttcaaaatattatgcgcttttgtatttctttcatcactgtcgttagtgtacaattgactcgacgtaaacacgttaaataaagcttggacatatttaacatcgggcgt 209|gttagctttattaggccgattatcgtcgtcgtcccaaccctcgtcgttagaagttgcttccgaagacgattttgccatagccacacgacgcctattaattgtgtcggctaacacgtccgcgatcaaatttgtagttgagctttttggaattatttctgattgcgggcgtttttgggcgggtttcaatctaactgtgcccgattttaattcagacaacacgttagaaagcgatggtgcaggcggtggtaacatttcagacggcaaatctactaatggcggcggtggtggagctgatgataaatctaccatcggtggaggcgcaggcggggctggcggcggaggcggaggcggaggtggtggcggtgatgcagacggcggtttaggctcaaatgtctctttaggcaacacagtcggcacctcaactattgtactggtttcgggcgccgtttttggtttgaccggtctgagacgagtgcgatttttttcgtttctaatagcttccaacaattgttgtctgtcgtctaaaggtgcagcgggttgaggttccgtcggcattggtggagcgggcggcaattcagacatcgatggtggtggtggtggtggaggcgctggaatgttaggcacgggagaaggtggtggcggcggtgccgccggtataatttgttctggtttagtttgttcgcgcacgattgtgggcaccggcgcaggcgccgctggctgcacaacggaaggtcgtctgcttcgaggcagcgcttggggtggtggcaattcaatattataattggaatacaaatcgtaaaaatctgctataagcattgtaatttcgctatcgtttaccgtgccgatatttaacaaccgctcaatgtaagcaattgtattgtaaagagattgtctcaagctcggatcccgcacgccgataacaagccttttcatttttactacagcattgtagtggcgagacacttcgctgtcgtcgacgtacatgtatgctttgttgtcaaaaacgtcgttggcaagctttaaaatatttaaaagaacatctctgttcagcaccactgtgttgtcgtaaatgttgtttttgataatttgcgcttccgcagtatcgacacgttcaaaaaattgatgcgcatcaattttgttgttcctattattgaataaataagattgtacagattcatatctacgattcgtcatggccaccacaaatgctacgctgcaaacgctggtacaattttacgaaaactgcaaaaacgtcaaaactcggtataaaataatcaacgggcgctttggcaaaatatctattttatcgcacaagcccactagcaaattgtatttgcagaaaacaatttcggcgcacaattttaacgctgacgaaataaaagttcaccagttaatgagcg 209|accacccaaattttataaaaatctattttaatcacggttccatcaacaaccaagtgatcgtgatggactacattgactgtcccgatttatttgaaacactacaaattaaaggcgagctttcgtaccaacttgttagcaatattattagacagctgtgtgaagcgctcaacgatttgcacaagcacaatttcatacacaacgacataaaactcgaaaatgtcttatatttcgaagcacttgatcgcgtgtatgtttgcgattacggattgtgcaaacacgaaaactcacttagcgtgcacgacggcacgttggagtattttagtccggaaaaaattcgacacacaactatgcacgtttcgtttgactggtacgccgtcggcgtgttaacatacaagttgctaaccggcggccgacacccatttgaaaaaagcgaagacgaaatgttggacttgaatagcatgaagcgtcgtcagcaatacaatgacattggcgttttaaaacacgttcgtaacgttaacgctcgtgactttgtgtactgcctaacaagatacaacatagattgtagactcacaaattacaaacaaattataaaacatgagtttttgtcgtaaaaatgccacttgttttacgagtagaattctacgtgtaacacacgatctaaaagatgatgtcattttttatcaatgactcatttgttttaaaacagacttgttttacgagtagaattctacgtgtaaagcatgatcgtgagtggtgttaataaaatcataaaaattattgtaaatgtttattatttaaaaacgattcaaatatataataaaaacaatctacatctatttcttcacaatccataacacacaacaggtccatcaatgagtttttgtctttatccgacatactatgtgcatgtaacaaatcaaatacatcttttaaatttttatacacatctttacattgtctaccaaaatctttaataaccctataacaaggaaaagacttttcttcttgcgtggttttgccgcgcagatattgaaataaaatgtgcatgcacgacaacttgtgtttactaaaatgctccttgcctataccgcaaaaccggccatacatttcggcgattacacgcggacaattgtacgattcgtctacgtgtaaacgatcatcataatcactcttgcgcaaacgaataaattttttcaccgcttccgacaaacgaggcaccaattcggcgggcacgcttcgatacattattctgtgcacataagttaccacacaaaatttattgtaccaccatccgacaacgtcgttattagggttgaacacgttggcgatgcgcagcagtttcccgtttctcatgaaatattcaaagcggcccaaaataatttgcaagcaatccaacatgt 209|cttgagaaatttctcgttcaaaattgttcaaagagaatatctgccatccgttttgaacgcgcacgctgacgggaaccaccgcatcgatttgctccaacacttcacggacgttatcgtcgatgcccatcgtttcgctggtgctgaaccaatgggaaaggctcttgatggaatcgcccgcgtctatcatcttgaccgcttcgtcaaaggtgcaactgccgctcttcaaacgccgcatagcggtcacgtcccgctctatgcacgacataccgtttacgtacgattctgataggtattcctgaactatacggtaatggtgatacgactcgccatacacgtcgtgcacctcattgtatttagcataataattgtaaattattaactttgcagcgagagacatgttgtcagtaaagcggtgctaggctcaataatactgatgtacaggcacgcgtgctatttatatataatttcgcaaggaggggagctgttatcggttgctattattaaagaatggccgtctgtttttatcacaagcttggcagcctcaaccatgaagcgtcgtcattgtaaattaaattctctgcctcaagaattatttgacaagattgtcgagtatttatctttatctgattactgcaatttggtgcttgtctgtaaaagaccttctagtaaatataacgtgatatttgatagtactaatcaccaacatttgaaaggcgtgtacaaaaagacagacgtgcaaataacaagctacaacgaatacatcaactgtatttgcaacgaactgagacaagacgaattctatgccaaatcatcatggattgcgagtatttgcggtcaccagagagcgacaatttttagtgtaacaaataaacaagtagaaatgaaatatcatttgtataatatagcaattgtggaaagtgaagattgcaacggattttacccatttgagccaacgcgcgattgtttaatatgcaaacaaaaaaaccaatgtcctcgtaattcatttattgtttcgttgtgtaaatatttagaaaaacaaaatgtacaatcaaactttatatattatttatacgaaataaatacataataataactattatacatgtttttattttacaatacttcctgtataacctctctaactacattaggagtacaatccacgtcaattacacgtttagctatttttctaattttgtaatgtttatcgtagagtttttcgttaatacattgaatagccaacaagggatttgggtgcacaccgtcatagagtacttccatgtcgtcttcaaagcgcatttttcgcttgcgaaaatgccgctcttggcccaaaacaaaagcgagtttgatgcggtcgtcgatgcgttccgaaaatacggccaaatgctggtgtttggtga 209|tgtcgcgcggaaacgtcaccgtgccatttttgctttccgccacgacggcggttttcaatttttcggccgactgcagcatgttaagtttggcgtcgagttcgtgcaaacgcaattcaaactgctcaaacctgttgcccacctcgttcttgaacgtctcgtgggtgaccataaatttttcgctgtttgcattcagtttctttacatgttttaaaacagattcaatcttgtcgcgcaaatcatcacgctcgccttcagtttgaatgtgcagcaacgcgttgcttttgttggcaaaatttaaccgcatcaaaatttccaacaacccgtgcttggtcgcgaacaatgcgcccaacgagttgagatcgcgtttggatctctgtttgtgaaaaacaatttcgtttaaatggtaaacttgatcgccgtcccaattgcaatcaagtatgtcgtcgtgcgcaatttcaagacctttgcaaaaatctatcacattgtagcattttgcgttcgtgtcgctgtgcacgtatctgtacttgaaactgtgcgtgttgcatttgaatgagtcccatttaacgatgtgcgaccattgttgggcgtttatgtggtactttttgtagtcgtctgcattgaaccgatcttcggcggcgatggcgtcgttgtcgttgtcaccggaccacatccaccagttccataaccaggatagcattgctttagcttgtctagcaattcctttgttatacaacgagaaaatttcgttcccttataattatagctgtacggtgcgcgtatttgtttgttaacgttacaaaaaatatccctgtccacgtccggccaatactgcaacgtgagcgcgtccaagtttgaatcttgcatatgcggaacgtacaaacgtacggcctctctcacacaatgcgcaaaactgcccggctgaatgtaatcactgtccaactttgcaggtttctcgaaagccttgtaccgatgcacgcgaacattttgagcggacgtgattttaaacttgtcggtgaattttaaccacaaatgaaatccacggttgccggtatacatgactcttgacacgttctcttccgtgtaaaacaacagaaacgccgtggcgccaatgtaaattttcagcattaaatcgtgttcgtcaacataatttttgtaatcggcgtctacgacccattccctgccgccgccgtcgtccaacggtttgacgtgcacgtcggacactttgttttgcacaatataactatacaattgtgcggaggtatcaaaatatctgtcggcgtgaatccagcgcgcgttgaccgtcatgaacgcgtacttgcggctgtcgttgtacgcaatggcgtcccacatcatgtcgacgcgcttctgcgtataattgcacactaacatgttgccctttg 209|aacttgacctcgattgtgttaatttttggctataaaaaggtcaccctttaaaatttgttacataatcaaattaccagtacagttattcggtttgaagcaaaatgactattctctgctggcttgcactgctgtctacgcttactgctgtaaatgcggccaatatattggccgtgtttcctacgccagcttacagccaccatatagtgtacaaagtgtatattgaagcccttgccgaaaaatgtcacaacgttacggtcgtcaagcccaaactgtttgcgtattcaactaaaacttattgcggtaatatcacggaaattaatgccgacatgtctgttgagcaatacaaaaaactagtggcgaattcggcaatgtttagaaagcgcggagtggtgtccgatacagacacggtaaccgccgctaactacctaggcttgattgaaatgttcaaagaccagtttgacaatatcaacgtgcgcaatctcattgccaacaaccagacgtttgatttagtcgtcgtggaagcgtttgccgattatgcgttggtgtttggtcacttgtacgatccggcgcccgtaattcaaatcgcgcctggctacggtttggcggaaaactttgacacggtcggcgccgtggcgcggcaccccgtccaccatcctaacatttggcgcagcaatttcgacgacacggaggcaaacgtgatgacggaaatgcgtttgtataaagaatttaaaattttggccaacatgtccaacgcgttgctcaaacaacagtttggacccaacacaccgacaattgaaaaactacgcaacaaggtgcaattgcttttgctaaacctgcatcccatatttgacaacaaccgacccgtgccgcccagcgtgcagtatcttggcggaggaatccatcttgtaaagagcgcgccgttgaccaaattaagtccggtcatcaacgcgcaaatgaacaagtcaaaaagcggaacgatttacgtaagttttgggtcgagcattgacaccaaatcgtttgcaaacgagtttctttacatgttaatcaatacgttcaaaacgttggataattacaccatattatggaaaattgacgacgaagtagtaaaaaacataacgttgcccgccaacgtaatcacgcaaaattggtttaatcaacgcgccgtgctgcgtcataaaaaaatggcggcgtttattacgcaaggcggactacaatcgagcgacgaggccttggaagccgggatacccatggtgtgtctgcccatgatgggcgaccagttttaccatgcgcacaaattacagcaactcggcgtagcccgcgccttggacactgttaccgtttccagcgatcaactactagtggcgataaacgacgtgttgtttaacgcgcctacctacaaa 209|aaacacatggccgagttatatgcgctcatcaatcatgataaagcaacgtttccgcctctagataaagccatcaaattcacagaacgcgtaattcgatatagacatgacatcagtcgtcaattgtattcattaaaaacaacagctgccaatgtaccgtattcaaattactacatgtataaatctgtgttttctattgtaatgaatcacttaacacacttttaattacgtcaataaatgttattcaccattatttacctggtttttttgagaggggctttgtgcgactgcgcacttccagcctttataaacgctcaccaaccaaagcaggtcattattgtgccaggacgttcaaaggcgaaacatcgaaatggagtctgttcaaacgcgcttatgtgccagtagcaatcaatttgctccgttcaaaaagcgccagcttgccgtgccggtcggttctgtgaacagtttgacacacaccatcacctccaccaccgtcaccagcgtgattccaaaaaattatcaagaaaaacgtcagaaaatatgccacataatatcttcgttgcgtaacacgcacttgaatttcaataagatacagtctgtacataaaaagaaactgcggcatttgcaaaatttgctaagaaaaaagaacgaaattattgccgagttggttagaaaacttgaaagtgcacagaagaagacaacgcacagaaatattagtaaaccagctcattggaaatactttggagtagtcagatgtgacaacacaattcgcacaattattggcaacgaaaagtttgtaaggagacgtttggccgagctgtgcacattgtacaacgccgagtacgtgttttgccaagcacgcgccgatggagacaaagatcgacaggcactagcgagtctgctgacggcggcgtttggttcgcgagtcatagtttatgaaaatagtcgccggttcgagtttataaatccggacgagattgctagtggtaaacgtttaataattaaacatttgcaagatgaatctcaaagtgatattaacgcctattaatttgaaaggtgaggaagagcccaattgcgttgagcgcattaccataatgccatgtattttaatagatactgagatctgtttaaatgtcagatgccgttctccttttgccaaattcaaagtattgattattgtagatggctttgatagcgcttatattcaggctaccttttgtagcattagcgatagtgtaacaattgttaacaaatctaacgaaaagcatgtaacgtttgacgggtttgtaaggccggacgatgaaggtacaacaatgccttatgtcattggaccattatattctgtcgacgctgctgtcgccgaccgtaaagtgaaggacgtggtggattcaattcaaaaccaa 209|cagacaatgttaaaagtatttattaacgaggctaatgtgtataacaaatggaatatgcttaaaggtttaatttataataataacaatgaatctgttttagtaaaataatgtagtaaaatttataaaggtagataaaaattataatattaataaaaaaaataatgttactaaatgggttcctgcgttaaattattttacgggtagacagctattaactattttatttatttttaaatttaaataaatgtattgttagaaaattgtgttgttttattagtataacgaaaaaatacatgacataaaccgcttccaattttggtcacacaaactcttgtgtggatagtttacgtaatgagttaaataggcgggcagttgtccgctaaacgtgtcggtggtcaagtagatgtgcattaatttacgacaacccaaagcggggccgcttatgtcaagtatttttttcacaaaattggtaatggtttcgttttgttccttgtacaaacacatgtcggtgtgatcgttgacgcacgagttgtacgattccgccggcaggttggcaaacaagcgcttgagatgcttgagtctgcgttcaattttataatcaaacttgttggtgaaaatgtctttcagcaagcacattaactggtcgttcaaaacgcgctgcaacgacgacaccaacacatgatattcgtttccaaaaagcgaaaaatttttgatgcagcggtccgcgttgaagggtcgtttcataatgcgcacgttgacaaaaaacacgttgaaagacagcggggctgtggttattttaacgccgttgtcggtatactcgtcgacgccgtctgcgcttgttatgtcaatttgtagcgcaaatctaaccaaatcaaactcatcgttgtactgtgtctttatgcattttatatggcggtttaagtgcaagttgatttggccgtttaatctataggctccgttttgataacatttcagcactaccaacggatccgacatgtaaacttgacgcgttagcacgtccaattcagcgtaatgttggtcgacgcatttttgtaaattagtttgcaggttgcaaaacatttttgcgcaaaagccgtaatagtcaaaatctatgcattttaatgcgcttctgtcgtcgtcaatatggcatgtcacggctgcgcctccagttaacacgaataaaccgccgttttcgcaaactacggcttcgaaacaatctttgataaatgccaactttgctttagccacaattttatcgcgcaggcgatcttcaatatcctttgtcgtaatataaggtaggacgccaagatttagttgattcaacaaacgttccataatgaatagcggcgacgcaacacgactacactgttcaaatgcgcacgcaaaacaaacccttgcaa 209|ctttatttgccaatcgtaatcacagtagtttttacgagtacgccatcgcgtttgtaagcacattgctttttaaaaataatttaaatttaatgaccgcgtgcaatttgatcaactcgttgatcaactttgaactcaacatgtttggtaaaagtttattgctaaatggatttgttaatttctgcattgctaacagcgacggggttacgattcaacataaaatgttaaccaacgtgttaagttttttgttggaaaaatattattaaaaataaataaataaacttgttcagttctaattattgttttattttttataaaataatacaattttatttatacattaatactttggtatttattaatacaattatttacaatactttatttacactataatactttatttacattagtactaaattaatactaaattacgctaatactaaattaatactttatataatcaaaaataatactttatataatactttctaatcatcataaacgggtaatagttttttctcttgaaatttacgctgcaactcttcgctaaaacacatgggcggtggagtgggagcgggtggagtaggagtccttacgggtttgatgggcgacagttctctggacttgcggaacagcttgggcgaaaacgtcggcgtgcgccgactaatgatttcttcatcgcacgaggcgtcgcacattgtgcacgcgtccggtgaggtacacaaaactttcttgggcacgctgtacaccggcttgggcacgctatatgtgttgccaaaactagaactcgttgtggttgccgaacggagacgatgggtgtgaagacggcgatggctgtgaagacaagtccgaaggcgcgataaaagatgaaagtgtttctgaaaccgaagtggtggtagaagtggtagaaggcgggtgcgttacggcaaccacgctgctgctatttctgccttcggagaccacttccagcaatctagagttactctctcgttcttcgcggcgatagtcaatgtcgcaataatgttcataagatgccttttcggcttcggcgcgccttttcatgtatatgttgtgacgcatctcctttaactgcacgtacaaattccagcattgcacagccagtatcgtaagcacgcccattatgattacgggataattttgattaaacacggtcggctcgtgatcgcttacaatcgctcggcacatgatgcattttttgtaaatgttcacatacacacagttttggctcaaggtttcggtatttgcgtagtcaatttccagatacacgatagagttccagcacattgattccaaatcgtagtgacgatataaaacatctagcgccggtagatgaccatttttgaacacgtagatttgaaacgcggcaaacagcatccaac 209|acagcccagtgatcacgtttaccataatacacgtgatagcgacgtaaaagttttctttcgcattgaaatttacatttgtgtttgaagagctgctgcgatttttcgtccacacgataatcttccatataaaataaaacatgtaaaataatatccacatgccgaacgccagcattatcggtatagatagattgataaccgattgctttccttcaatttccagcaaaaacgcgtatctgctgtctatcactcccattatagataacacaaacactatcagatatgctaataataatgaggcattaagcccgaattgtaaaactgcagtgattttatttaacattttgaatatttaattcaacaactaagtaatggcaatatgtatcgagtactgatcgtgtttttcctgttcgtgtttctttatatagtgtaccagcccttttatcaggcatacttgcatatcggacatgcccaacaagattacaatgacacgttggacgataggatggattacattgaatccgtaatgcgtagaaggcactacgtgccgattgaagcgttgcccgcaatcaggtttgatactaatctcggcacgttggccggtgacacgattaaatgcatgtcggtgcctttgtttgttagtgacattgacctgccgatgtttgattgtagtcagatatgcgataacccgtctgcggcgtatttctttgtcaacgaaacggatgtgtttgtggtcaacggccacagactgacggtgggcggatactgctccactaatagtttgccccgcaactgtaatcgcgagacgagcgtcattttaatgagtctcaatcagtggacgtgcatagccgaggacccgcgttactatgcgggcacagataacatgacgcaactcgcaggcagacaacactttgaccgcattatgcccggacagagtgataggaacgtcctgtttgaccgattactaggccgagaggtgaacgtgaccactaacacgtttcgccgcagctgggacgagttgctggaggacggcactaggcggttcgaaatgcgctgcaacgcccgagataacaacaataatctcatgtttgttaatccgcttaatcccctcgagtgtctcccgaacgtgtgcactaacgttagcaacgtgcacaccagtgttagacccgtatttgaaacgggagagtgtgactgcggcgacgaagcggtcacgcgtgttacgcacattgtgccgggggacaggacctctatgtgtgccagcattatagatggcctggataaaagtacggcatcatatagatatcgcgtagagtgcgttaatctgtacacctctattctaaattattctaataacaaattgttatgtcccagtgacacttttgatagtaacacggacgcagctt 209|ttgcctttgaagtgcccggctcctaccctttatcgcgcaacggcatcaacgagccaacttatcgcttttatcttgataccagatctcgagttaattacaatgacgtcagagggcagttatcttaattgtgataacacaaacaataagtcatttaaatgttacgtcagtagttagtatataagccgtacatgttggcttgcaaattcagtcaatatcaggcttttatcatggacggtgtaaagctgctagggacgtgcgcgctaataattttgttatcgacgacgagtacagttgtcgggcgtgaccgtatcacgtttacgccgatagaagatagcgcaggcctcatgtttgaacgcatgtacggcttgcgacatcatacagacgacagatttgtgtttgtgaaaaaattcaattttgtttcggtgctgcaagagctcaataatatcaaatctaaaattgaattatatgaagcgcaagtttcaacttgcacaaacgtcagacaaataaaacagaacagatcgagtatcatcaaagctcgcattgaaaatcagctgcagtttttgacgcaactaaacaaaaatctcatcacatactctgtggaaagcagcattttaagcaacgacgtgctggacaacatcgatctggaatatgacgacagcggtgagtttgacgtttacgacgaatacgaacagccttcgcattggagcaacatgactgtatccgacgcgcaagctttgctccgaaacccgcccaaagacagagtaatgtttttggacacggttaccaccagcgacgtgagcagcaaatacgaagaatacataaactgcattgtgagcaaccgtaccgttgaaaacgagtgcatgtttttagccaacatgatgaacgtgctcaacgacaaattggacgacgcagcagctttggccaagatgctggagcgaatagtaaaacaaacgcgaaagaacaaactcaacatctccaacacggttatagacgacgacacgctgctaacggaaatgaaaaaattaacacaaactttatacaaccaaaaccgcgtgtgggtagtggattttaacaaggacatgaatagttatttcgatttgtcgcaagcgtataaattgcatttatatgttgatttaaacacggtcattatgtttattaccatgccattgttaaaatccaccgccgtttcgtttaatttgtatcgcgtcatgacggtgcctttttgcaggggcaaaatgtgtctgcttatcatttcgggcaatgaatactttgggattacagacagcaaaaactattatgtgcccgtatctgataactttagacaagattgccaagagtttacgggctacaatgagtttttgtgtcccgaaactgagccgattgccactatgaactcgaaa 209|gtgtgcgagattgaaatgtttatgggtcgatatagcgacgacgtggacaacatgtgcgacattagggtggccaattataatcccaaaaaagcttacgtgaacactttaatagactaccgaaaatggttgtacatttttccaaacacgaccgtgtccgtccactattattgtcacgacgcgcttgtagaagttgatacaaaagtttcgcccggcgttggtgttatgttttcgactatggcgcaaacgtgttcgattagaataacgtatgatgtgaccataactgtagattcgcgattttatgtcagccattcaactacatactggcctaaaaagaaatttaattttaacaactacatcgaccaaatgttgcttgaaaaagcgaccaccagttttataccgactgttgacaattttacccggcccgttttattgcaacttcctcataaatttcacattaaagattacacatcgacgccccatcattttttccatcagtctaaaatttacaccaacagcgcggcgcccgacgaagactcgcaagacgacagtaataccaccgtggttattatcgctattgtcgctgcaatgatcctattctgtggattattgttatttttgttttgctgtataaaaaaacggtgtcatcaatcaaataacgtggttgtgcaatacaaaaataacaatgaatttgtcacaatttgcaataatttagaagacaatcgagcatacattaatttacctaatgaatacgatagcgatgatatgccaaaaccattgtaccctttacttggctttaatgatgatttgttaaaagatgataaacctgtgttgtaccctatgattatagaaagaataaaataaaacatgtataattgaaataaatatattatttaataaaatgttttttatttatatactattttctattacatattccaatgcacacaaatgtttaatggctatcagttttaattttactaattcgtctaaacaaaaattattcacttgctgtttttcatccatttgacatatggcgtttataaataattcgctgtgttttatgaacgaatcgtaaaccgctgcctgggccttcagcacggtcggcgcattgtatttttgggtaaagtacgcaatatttttagtcaaacacagagattttaaatctttttcatttatatccaagtcggaacaatcgtatacaaaatctagcttttcactttcgggcgcgcccagatactggtttacgagttcgagctgctccacttggcctttgatatcggccgctatgcacaacattttgtcgattgcagtttcattgtttttaacataataatttttaacttttttattttgcaatttaatcaaactatttaaattcgcttgacctttcttacaaagcg 209|cagttaatatgcaagacattttgacttataataaaaaacaaaacttttatatattcatttattgttcaataataacaaatattccaggcttaaaagctaacgaatagggcttttcggtaattttcttattattcatgtccgtcatctgcatctctttgccgtacttgacgccgtcaatggtgcccatcatgtacattttaatctcctccgaaggtccgtctattttgtccatttcgaacaatctatcaaaatcttcaacgctcattctctgcatatcaagaggaacgtttctgatctttccggtggcgtaaattgatccgttgttgtcacggttgattatgtaaaaccgacgaatcaacatgtcgcgctcgctagttttgttcttatccggcaaatgaatgcacacgtttggttccatcttcaaaggaaaatcgctttgcaagtgtttttgcaaaatgttgccaaatatattgttgtgtttgtgaatgtctccgtattgaatgctaaaaaactggccaaagttgcttttggcacgttttatggttccaaagtcggaaaaccaaaatccgcagggcttgccctgcactcttggaccgatggtgtacgtagtcttgccgttggccggctccaacaccacgatatttttatcgggctcgggatacaacttgtcttcccattcgtgcaaactgttcaaattagacagtcgacaaaattcgtttttcaaaaatctgccttcgaaacaactacaattcagtattgaaaagttgcctcgtttcacattaatcgccatctgctcctgccacaacatcttcgtcaactcgtgtggctccaattgaatggacgacggcgtaaaatagcacattacgcccgtttcgtcgtgtttcacgttaaaagcgccgctgttgtacggcaccagctgctggtcctcaccaccttccgatctttcccgcttcggctggttgtcgtcgctgctcgaatatccatcgccaatcttgcgtttagttgccatgctaccgacgtgcgctgtctgctgtggttcaagtctaattgaagtgtttcacagaatataagatatataataaatatggacgactctgttgccagcatgtgcgtagacaacgcgtttgcgtacactactgacgatttattgaaaaatattccttttagtcattccaaatgcgcccctttcaagctacaaaattacaccgttttgaagcggttgagcaacgggtttatcgacaagtatgtggacgtgtgctctatcagcgagttgcaaaagtttaattttaagatagatcggctaaccaactacatatcaaacattttcgagtacgagtttgtagttttagaacacgatttgtccacagtgcacgtcattaacgccgaaacaaaaaccaaac 209|tgggccatataaacgtgtcgctaaaccaaaacgacgcaaacgtgctcattttgaccgtaactttaacgagctaaaatgaacgaggacacgcccccgttttattttatcagcgtgtgtgacaactttcgcgacaacaccgccgaacacgtattcgacatgttaatagaaagacatagttcgtttgaaaattatcccattgaaaacacggcgtttattaacagcttgatcgttaacgggtttaaatacaatcaagttgacgatcacgttgtgtgcgagtattgcgaagcagaaataaaaaattggtccgaagacgagtgtattgaatatgcacacgtaaccttgtcgccgtattgcgcgtatgctaacaagatcgccgagcgtgaatcgtttggcgacaacattaccatcaacgctgtactagtgaaagaaggcaaacccaagtgtgtgtacagatgcatgtccaatttacagtcgcgtatggatacgtttgttaacttttggcctgccgcattgcgtgacatgattacaaacattgcggaagcgggacttttttacacgggtcgcggagacgaaactgtgtgtttcttttgcgactgttgcgtacgtgattggcatactaatgaagacacctggcagcgacacgccgccgaaaacccgcaatgttattttgtattgtcggtgaaaggtaaagaattttgtcaaaactcaattactgtcactcacgttgataaacgtgacgacgacaatttaaacgaaaacgccgacgacattgaggaaaaatatgaatgcaaagtctgtctcgaacgccaacgcgacgccgtgcttatgccgtgtcggcatttttgcgtttgcgttcagtgttattttggattagatcaaaagtgtccgacgtgtcgtcaggacgtcaccgattttataaaaatatttgtggtgtaataaaatggtgttcaacgtgtactacaacggctattatgtggaaaaaaaattctccaaggagtttttaattcatattgcgcctgatttgaaaaacagcgtcgactggaacggcagcacgcgcaaacagctgcgcgttctagacaagcgcgcctacaggcaggtgttgcactgcaacggcagatactactggcccgatggcacaaagtttgtctctcatccgtacaacaaatctattcgcacgcacagcgcaacagtcaaacggaccgacagctcgcatcgattaaaaagccacgtggtcgacaaacgaccgcgccgctctttagattctcctcgcttggacggatatgttttggcatcgtcgcccataccacacagcgactggaatgaagaactaaagctgtacgcccagagccacggctacgacgactacgacgacaatttagaagatggcgaaatcgacgaac 209|gtgactctttaaaaagtttaaataatcatctagacgacttgaatgtattagaaaaacaataaaacatgtattaaaaataataataataaaactatattttgtaatatataatgtattttatttaaaaattgtctattccgtagttgagaaagttttgtcttgacttcataactctcttctccatattctgcagctcgtttacgttttttgtgacgcttttaattttctcaaaatgctggctgtcaatagttattttttgcttttgtctattaatttcttccaattgagattttaaatctcgctgagattgagatgcgttgtaattccttgagaacatcttgagaaaacatacagatgaggtaaaacagcatcttttatccaaattaggagttaattattattcatttgtatcgcgaccatttgctcgtacacatcttccataaaatggttatttttattgcgataagtgttggcattgacattttgcaaatgtcgtaggttaaaggggcaaatgggctgcgtggccgataaaagattccagttcaacaatccctcttcgcccccgtttaacttgaaaatggcgctacacgtttctacgctatcgtgttcctgttgagtggcgcacggttcgaccagtatcatcttgtgatatgcggttttgacattcatgtgcaacggaataacttgcgggtcatcgcattcgtcggaattaagctttaaatggcgtccgtatgctttccaaagtttttcgtcgtcgaaccgcggcactgcttgcaagtcgacgcggggaaacggcgctctgtacaaaacgcctaaattcaaaaactgattgcattgttgcagctctgtccaatcgacgcgatttttgtaattttgaaacagcatcaggttgaacgccgcgctggcgcgcacgtttgtaatcactgtgtaattgatcagcttgtgccaatactgggcattgaaattttcttcaaactcatttctaaactctggatgcgcaaacatgtgtctaatgtagtacgcgggcggggcgttgaacgcagtccatttgtcaatacacttccagtctgaatgtaacgtgttcaccaaaccgggatattcgtcaaacacgagcatgtgatccgaccacggtatgctgtgggcgatcaattttagttcttgcacgcggccttcgcgtaagcaatacaaaatgagcgcgtcgctgatcttgacacagtcttgcatgtacgcggacaaattaacgttttccatacagctcacattgtttattagcgccgtgttcaagtgtttgtatttggacacataatcgtagttgatgtactgtttaatgggttcttgaaaccattcttttagtagtatgtgactggccactatgcgtttccaatttaatttgtgtgcgt 209|atttttgctgcaccgacaacgagaggttattgtaatttttggatatttcttccatgtccaacaagtccccaaacgcgagtataaaatcttgcgtcaaaaatttttgctcagacaccaacgaccagatcaaatgtgatttaaacctgttggcgattgttatcgacaacggcgaaattgaaataattttccaatccaacttgttgcgaaacacgtgaataaaatcgacgcgtccgtaacattcgcgcgatatgcgcttccaaaacgtgtcatcttgcaaattaagcaaatagacacgattgttgggagatttgacggccaattcaattatttttatatattctttttgctttaaagcgcgttgtagcacttgggttggagccatgtcgactgaagctccacgctgtttgaagcaaggtgaccgttttggtcggcatgttcaaacgtcgattacatgtttgctttgcatcaaaatggcgtaattaattaagaaacaacatgaaagccatctgcatcattagcggcgatgttcatggaaaaatttattttcaacaagaatcagcgaatcaaccgcttaaaattagcggctatttgttaaatttgcctcgaggtttgcacggctttcacgtgcacgaatatggcgacacgagcaacggttgcacgtcggccggtgagcactttaatcccaccaatgaggaccacggcgctcccgatgctgaaattaggcatgttggcgacttgggcaacataaaatcggctggctacaattcactgaccgaagtaaacatgatggacaacgttatgtctctatatggcccgcataatattatcggaagaagtttggtcgtgcacacggacaaagacgatttgggccttaccgatcatccgttgagcaaaacaaccggcaattctggcggccgtttgggatgcggaataattgccatatgtaaatgatgtcatcgttctaactcgctttacgagtagaattctacgtgtaaaacataatcaagagatgatgtcatttgtttttcaaaactgaactcaagaaatgatgtcatttgtttttcaaaactgaactggctttacgagtagaattctacttgtaacgcatgatcaagggatgatgtcatttgtttttcaaaaccgaactcgctttacgagtagaattctacttgtaaaacataatcgaaagatgatgtcatttgttttttaaaattgaactggctttacgagtagaattctacttgtaaaacacaatcgagagatgatgtcatattttgcacacggctctaattaaactcgctttacgagtaaaattctacttgtaacgcatgatcaagggatgatgtattggatgagtcatttgtttttcaaaactaaactcgctttacgagtagaattct 209|acttgtaacgcacgcccaagggatgatgtcatttatttgtgcaaagctgatgtcatcttttgcacacgattataaacacaatcaaataatgactcatttgtttttcaaaactgaactcgctttacgagtagaattctacttgtaaaacacaatcaagcgatgatgtcattttaaaaatgatgtcatttgtttttcaaaactaaactcgctttacgagtagaattctacgtgtaaaacacaatcaagggatgatgtcatttactaaaataaaataattatttaaataaaaatgtttttattgtaaaatacacattgattacacgtgacatttacgatggcgaacaataatttcactttttatattaggacacgacgtgtatataggaaagcttaagcgtttcaataaagccatggcgtacacgctaagcttgcccagcttgcggctctttgaaatctgtagttttcggggagtaccgtcgttcttcagtgccacatacgtcaacttgcgatcgtacactttataatacgtgttgtagttatttttttccagaaattccctcataaagcaatccttggataaagtttttgatccgtacagttggccacaccggtccatgcacaggtacacacacgtgatggcgttttgaatgacgatgcgatttctgtcaacggcaacgcgcttgaatatggtgtcgacgttgtccgattcaatggttccgtaaacagctccgtctggatttactgccaaaaactgccggttaataaacagctggccgggaatagacgtgcccgtgatgtgtgtcagcagagctgagcagtcagccatagaggctagagctacaagtgccagcaagcgatacatgatgaactttaagtccccacagcaaactggcgcttttatataaaaatttgggccatttttggcgattagataatttttgaagattagataatattgagattagttaataatttgtgtgattagataactttttagggtattgcgcattataaatcaaggtcgagttgtataaactgctctggcgtgtaaaactgcagacttaagttttttgcaaacactcggtctgaatcgctaaaatctttctgaccggtggttagattaattcggccagccgcgtcgcccacataaaaagattgttccttgtcaatatgcgtaaactgtttggccatctcgcgccacattcccgtgtcgggctttcgatgctcatccttgttgggcgacacataaaacgatatgggcacgccagtagcttttttaatattctctaatttatataataaatcgctcgctttgattttgccggaacctaaatgggcttggttcgtaaaaacaactaaatcgtagcctaattcgtacaaacgctttagcttgtgtgcgc 209|acggaaggagctgccagtcgtctgggttttttggaaatttggaccgtgtctttgagctaattagcgtgccgtccaaatcaaaagccgcaattttggttcttttagcgccgtcatgaaccgcgtacgcatacaaatcgggctgctgtaacgtccacatggtgaatgcatcttactcaaagtccatcaattcgtacgcgtttgtgtccaggtcgggcgttgaaaaattgtagcttgccattagatcggatagcgattcaaattttgtaagcgtttgtagcgcacgtttggcatcttgtttaaaattacacgacgacagacagtaaaaatattcctcgataagcatgactacacccatatcactgtttaagtgctcgacgtagttgttgcatgttatgtcgcgtgtgccgcgatacgcgtgatttcggtgaaaatcacaccacaaccagtcggcgtgcgtgtaacaaagtcgacagcgaaacaatttatcgttttccaaaaaatttaaatactcgacagttttgcagcttagattccgcgtttgattcaccttaaaatcgtcgtcagcctctataatctcgggcaacagcttgccttgttgccccatcgtatcgatcacctcccccaagtggcccggtgttatattaagtcgtttaaaatcatttattgcttcctgcacgtcggcctggtaatttttgaccacgggcgtggaaatcaattgccgttgaagggaaataattcgtggtgtgggtatcggccgcctgttgcacaattccaccagcggtggaggcaagggcgcattcacagcaaccgttgtcatttataagtaatagtgtaaaaatgcaaatattcatcaaaacattgacgggcaaaaccattaccgccgaaacggaacccgcagagacggtggccgatcttaagcaaaaaattgccgataaagaaggtgtgcccgtagatcaacaaagacttatctttgcgggcaaacaactggaagattccaaaactatggccgattacaatattcagaaggaatctactcttcacatggtgttacgattacgaggagggtattaataataacaataataaaaaccattaaatatacataaaagttttttatttaatctgacatatttgtatcttgtgtattatcgctaaccattaaaagtgctggagccacagtgttgcggcgagtctttatagaagatcgttgtttggctggaactgagcttttccttttcctgctgccgctaatgggagtgggcacgtactctgtagtagacggtgcaacgggcaacttgagcgctaccgtcttaaatttggccatacttttagtgatgaaatcgcgcgttaacacttcgtcgtaaatgttacttagcagaggcgcaacattgtgattaaat 209|gtctcgtttaacaagctgtaaaactccgaataaagcttatcgcgcatttcgcagctctccttcaattctgccaaatttgcgttggtaagcaccacagtctgtctttttttgctcgctggaattgctgcgttctcgcttgaagacgacgatgtcgatcggtcggccatttttttgcccagcttttcagtgtgatcaaaaatgaacacaaaatctgccaattcgggcttgtttttcaccaaatcccacatggccgggctactaggccactcgggctgcttgatcttagtgtaccaactgttaaacaaaatgtatttattgttgttaatcactttcttcttgcgtttggacattttgcgttcgtcttgcatgacaggcaccacgttaaggatatagttaatgttctttctttccaagaaatttacaataacggccagctggtccatgttggatttgttgtaagagctcgattccagtttattcaacagcttttcatttttgcacacggccgcagtctccggagattgttgctccggcacgtttaccatgtttgcttcttgtaaacctttgaaacaacccgtttgtattcttgatgatatatttttttaatgcccaacaacctggcaattcgtttgtgatgaagacacaccttacgcttcgaacatttgtcggtgattactgtgaaatggcctaaattagctcttatatattcttttatacgctcaaacgacacgatgtccaacatgtgcgcgcagacgttttctgtgttcatcgtgtgcttgagcgtgttgatggcttccctgaacagcgcttgtatttcgctgcgagtcaagcagtccgaatcacacccgcctaagtgcgtgcaatttttggggggcatcgttgtctatctttttcagagtggcgtagaaaaagtcctgcaattgcctattatcaaaacgcgccttgacgctgcgcacaaaatcaaaaaattcaatgtaattgctgtaatcgtacgtgatcagttgtttgtcgttcatataattaaagtatttgttgagcggcacgatggccaggctgcgcgctatttcgcaattgaagcgtcgcggttttaacattatacggtagtcattgccaaacgtgcccggcaacaacttcacggtgtacgtgttgggtttggcgttcacgttaatcaagttgccgcgcacgacgcctacgtatatcaaatacttgtaggtgacgccgtcatctttccattgtaacgtaaatggcaacttgtagatgaacgcgctgtcaaaaaaccggccagtttcttccacaaactcgcgcacggctgtctcgtaaacttttgcgtcgcaacaatcgcgatgacctcgtggtatggaaattttttctaaaaaagtgtcgttcatgtcggcggcggg 209|cgcgttcgcgctccggtacgcgcgacgggcacacagcaggacagccttgtccggctcgattatcataaacaatcctgcagcgtttcgcattttacatatttgacacttaaaaaattgcgcacacgagcaccatcgtttgatacctaattgcaactatttacaatttatcagtttacgttgaacccgttttaattttttagatccgtccttgttcagttgcaagttgactaaatgacaaaatttttcggttctgcaaaaccgcccttgtctgttccacccgttgtatttgaaaaaactttttttcacgcggcgacaactgcttgtataatattgcccaatgtaaacatgcaaaattttgttactctcgtcaaaacagcggttggcgttccattccataatttttttattatttatcaacgatggccattgtaaattgtcgtcatttatacgcatcatatgatttaacaaaagcttttcgtatagcggaacttcaattcccttggaacatttttcaaacgataatttaatttgtttctcggttggcagcatttcatgcttgattaacaatcgcctgacttttatagccacgtttatgtctttgcacagcaaatgtgggttgtcgacaatgtaatagtgcaaagcatttgttacggcaaatgcgtagtttgatttgacgacgccctttttcttgacgggcattgcggcttttaaaattacttgcaagcattgtacgaatacctctttgtgtttaaacaataatatggacaaacatcggcgaaacaatttgtaataattatgaaatcccaaattgcaggttttaaacttctttgttacttgttttataataaataaaatttgctgacccatgtctgcgcccacaactttaattaaccatttgtgcgcatattgattgtctcgttgttcccaaccggaaaattgattgatctcgagccaccggcattggtcgtttgataccgtcgttaacgccgacgctcctgcctgtttgattacgggttctaaaagacgaaacagcagcgtaaatttgtttttgcgtcggtagtattttggcaggcaataatcaaaaaaatccgtaagcaattctctgcatctattaatattcgttgcgtacgaatcgagtttttcaaaaattactttgtttgtatgaaaataacgtttgggcttctcacaataataatcttcgttgtagaacagaaacggtttgcgagaattggcacgtttgtccatgattggctcagtgtaacgattgattcaaatcaaaattgacaacacgtttgccgtaatgtgcaccggttcgcacacgtttgccgcgtatgtaatccatgtttatttcgctgtcgcaattgattacacgattgtgttgggcggcgcgttttattgaa 209|tttaggcgacgcgtcgacaactccaaaggattgtaaagcgcagatttttccagagtaaacgagtttaagtggccaccgttgaaccattccagagccacgattgtgtacagcaaaaagaatatttctttgtcgacgttttcaaacgcaaacttgttttttaggcaatagtagtaaaattttaacgaattgtataaataaaacataaaattgccatttttaaagtaaaattctacatccgtgacgaacaaaaggtttactattttgttctccaacaagtgtgccaattttcttaagtacaccattgaatttttgtcgtcgtccatctcgatcaacaacacgtacggcgttttggaatttaaaattattctaaaattttcctgttgcaacgattccacagcgtccgaccaatatgacgctgccacctctagacagatgtatttcttggaaaacacgtgtcgtttgataacctcgctgatggacgtgatcgattgtaaatacttttcaaacgtcgcgtcttcccaaccacgcaccgaaacgggcgctgtcgtgtcgggctgatgtttgaaatccaaaccactctgaattaacttggttgtgattcgtatgctcaactgttgacccaacgtgtagtgatcttcgtaggcgcgctcccacatcacgttacacacaaatttgacgagatcatcaacgtctttctgttgcaaaattcgccgcaaacgcgccacatcgcccttgtaccaccgatctcggcacacaagctgtagcatttttaaatcgtgatcgctcaagctattaattctggttagatttatatagtcgtcaatatcctcgggcgtggtttgcgtcatgtctgtaaaacgtgcaaaatcaaacatttttatgttgtagtcgaatctaacaaatccatcggcgttcacttgcacttcgcgctttacaaaacgaggtagcgtgtaatcgaacccgtttaaatagattgcgtacaaaaccagcacttcatcttccagtttgcacgcttgcggcaaaaattgtgtggtgtgctccaaccgggtgacaaacatgactatggaaaataacgcggaattcaacagacgactagagtacgtgggcacgatcgccacaatgatgaaacgaacattgaacgttttacgacagcagggctattgcacgcaacaggatgcggattctttgtgcgtgtcagacgacacggcggcctggttatgcggccgtttgccgacctgcaattttgtatcgttccgcgtgcacatcgaccagtttgagcatccaaatccggcgttggaatattttaaatttgaagaaagtctggcgcaacgccaacacgtgggcccgcgttacacgtacatgaattacacgctttttaaaaacgtcgtggccctcaaatt 209|ggtcgtgtacacgcgcacgctacaagctaacatgtacgcggacgggttgccgtattttgtgcaaaatttttcagaaacaagctacaaacatgttcgtgtgtatgttagaaaacttggtgcgatacaagtagcgacattatcagtttacgaacaaattattgaagatacaataaatgaactcgtcgtcaatcacgttgattagataatgtccgtgttaaatgtgatatcttagattacgagcgcgcaataaccatagtttaatcgaagagaatagccgtcgccacaatggataattacaaattgcaattgcaagaattttttgaccaagcgcccgacaacgacgatcccaactttgaacatcaaacgcccaatctattggcgcatcagaaaaaaggcatacagtggatgattaacagagaaaaaaacggccggcccaacggcggcgtgcttgccgacgacatgggactcggcaaaacgctctctgtgctaatgttaatcgcaaaaaacaactctctacaattgaaaactctaatagtgtgtcctttgtctttaatcaatcattgggtaaccgaaaacaagaagcatgatttaaattttaacattttaaagtattacaaatctttggatgccgacacggttgagcattaccacattgtggtgaccacgtacgacgttttattggcacatttcaaattgatcaaacaaaataaacagtcaagtctgttttcaacccgctggcatcgagttgttctagatgaagcgcatattatcaaaaactgcaagacgggcgtgcacaacgccgcgtgcgctttgaccgcaacaaaccgatggtgcattaccggcacaccgatccacaacaagcattgggacatgtactcgatgattaattttttgcaatgtcgtccttttaacaatccaagagtgtggaaaatgttaaataaaaacaacgactctacaaatcgcataaaaagtattattaaaaaaattgttttaaaacgcgacaaatctgaaatttcttctaacattcctaaacacacggttgagtatgtacatgttaattttaatgaagaagaaaaaacgttgtacgataaattaaagtgtgaatcggaagaggcgtatgtgaaggctgtggcagcgcgtgaaaacgaaaacgcactaagccgattgcagcaaatgcagcacgtgttatggctaatactgaaattgaggcaaatctgctgccacccgtatttggccatgcacggtaaaaatattttggaaacaaacgactgttttaaaatggattatatgagcagcaagtgcaaacgagtgctcgacttggtagacgacattttgaacacaagcaacgacaagataatattggtttcgcaatgggtggaatatttaaaaatatttgaaaa 209|cttttttaaacaaaaaaacattgctacgttaatgtacacgggccaattaaaagtggaagacaggattttggccgagacgacattcaatgatgctgccaatactcaacatcgaattttgctgctttccattaagtgcggcggcgtcgggttaaacttaataggcggaaaccacattgtaatgttggagcctcattggaacccgcaaattgaattgcaggcgcaagaccgaatcagtcgtatgggacaaacaaaaaacacgtacgtgtacaagatgctaaatgtggaagacaacagcatcgaaaaatacattaaacaacgccaagacaaaaagattgcgtttgtcaacacggtctttgaagagactctgctcaattacgaagacattaaaaaatttttcaacttgtagctggtaagtcgtcatgaacacccgatatgctacttgctatgtttgcgacgagttggtgtacttgtttaagaaaacgtttagtaacatgtccccttcggccgctgcgttttaccaacggcgcatggccattgttaaaaacggtatcgtgctgtgcccacgttgttcgtcggaactaaaaattggcaacggcgtttcgattccaatttacccccaccgcgctcaacaacatgcacgacggtcgcgttaagacgcaagcgcttcgagttttggcccgctcgctacctccgctgtacgactcgaccgtcgatcgacacggctgcaaggtgttcacggtgcggcgctacaacagacgcgtaatcgactttgcgggcattcgcaacaaaacgctggaaatcattaaaacggatagaaacttgccgctcaacacagaatgcaatgtgaaagttgtcgacagtgcatgcatgcgttgcagaaaaagtttcgcagtttaccccgccgttacctatctgcattgcggacattcgtgtctgtgcaccgactgcgacgaaacggtaaacgtggacaacacgtgtcctaaatgtaaaagcggcattagatataaattaaaatacaaaactttgtaacatgttgccctacgaaatggtgattgccgtgttggtttacttgtcgccggcgcagattctaaatttaaaccttccttttgcataccaaaaaagtgtgctgtttgccagcaactctgcaaaagttaacgaacgcatcaggcggcgagcgcgtgacgacaacgacgacgacccctatttttactacaaacagttcataaagattaattttttaactaaaaaaataataaatgtttataataaaactgaaaagtgtattagagcgacgtttgatggtcggtatgtggttacacgcgacgttttaatgtgctttgtaaacaagagttatatgaagcaattgctgcgcgaggttgacactcgcattacactacagc 209|aacttgttaaaatgtatagtccagaatttggtttttatgtaaatagcaaaattatgtttgtgttaactgaatcggtgttggcgtctatttgtttaaaacactcgttcggcaaatgcgagtggttggacaaaaatataaaaactgtgtgtttacaattaagaaaaatttgtattaataataagcaacattcgacatgtctatcgtattgattattgtcatagttgtaatatttttaatatgttttttgtacctatcaaatagcaataataaaaatgatgccaataaaaacaatgcttttattgatctcaatcccttgccgctcaatgctacaaccgctactactaccactgccgttgctaccaccactaccaacaacaacaacagcatagtggcctttcggcaaaacaacattcaagaactacaaaactttgaacgatggttcaaaaataatctctcatattcgtttagccaaaaagctgaaaaggtggtaaatcccaatagaaattggaacgacaacacggtatttgacaatttgagtccgtggacaagcgttccggactttggtaccgtgtgccacacgctcatagggtattgcgtacgctacaacaacaccagcgacacgttataccagaaccctgaattggcttacaatctcattaacgggctgcgcatcatttgcagcaaactgcccgatccgccgccgcaccaacaagcgccctggggcccggtcgccgattggtaccatttcacaatcacaatgcccgaggtgtttatgaacattaccattgtgctaaacgaaacgcagcattacgacgaagctgcgtccctcacgcgttactggctcggcttgtatctgcccacggccgtcaactcgatgggctggcaccggacggcaggcaactcaatgcgcatgggtgtgccctacacgtacagtcaaatcttgcgcggatattcattggcgcaaattaggcaagagcagggaatacaagaaatcctaaacacgatcgcgtttccgtacgtgactcaaggcaacggcttgcacgtcgattcgatatacatcgatcacattgacgtgcgcgcttacggctatttgataaattcatactttacgtttgcctattacacgtactattttggagacgaggtaatcaacacggtgggtttgacgagagccatcgaaaacgtgggcagtcccgagggagttgtggtgccaggcgtcatgtctcgaaacggcacgttgtactctaacgtgataggcaactttattacgtatccgttggccgtccattcggccgattactccaaagtgttgaccaaactttcaaaaacatattacggttcggttgtgggcgtaacgaataggttggcttactacgaatccgatcccacaaacaacattc 209|aagcgcccctgtggaccatggcgcggcgcatttggaatcggcgcggcagaattatcaactataatgccaacacggtgtcgtttgagtcgggtattattttgcaaagtttgaacggaatcatgcgcatcccgtcgggcaccacgtccacgcagtcgttcagaccgaccattggccaaacggctatagccaaaaccgacacggccggcgccattttggtgtacgccaagtttgcggaaatgaacaatttgcaatttaaatcgtgcacgttgttctacgatcacggcatgttccagctatattacaacattggcgtggaaccaaactcgctcaacaacacaaacgggcgggtgattgtgctaagcagagacacgtcggtcaacaccaacgatttgtcatttgaagcgcaaagaattaacaacaacaactcgtcggaaggcaccacgttcaacggtgtggtctgtcatcgcgttcctatcacaaacatcaacgtgccttctctgaccgttcgaagtcccaattctagcgtcgaactagtcgagcagataattagttttcaaacaatgtacacggccacggcttcggcctgttacaaattaaacgtcgaaggtcattcggattccctgagagcttttagagttaattccgacgaaaacatttatgtaaacgtgggcaacggcgttaaagccctgtttaattatccctgggtaatggtcaaagaaaataacaaagtgtctttcatgtcggctaacgaagacactactataccatttagcgttataatgaattccttcacctctatcggcgaaccagctttgcaatactctccatcaaattgctttgtgtatggaaacggtttcaaattgaacaacagcacgtttgatttacaatttatttttgaaattgtgtaattatatttagggagaatgtgatattcaaaagactgactgttaacacaaaagactgatattgttgttgttacaaaatagataataaaacaaaaaataaattaaatattatttatttattaaactgtttaattttaatgctaacgcgtacaaatcacgctgttccgacgtggacatggaattgcgcagaaaagtcttgatagtgtcgatttcttcgccgtcatccacttccatatatttgatttcttcctcgatttgcatttccaagtttgcgtattcttgcaaataataatctagtcgttgggcgacctcgccaattttaaataatacattatccgacaccaaatgccagcgagtgactgtgcgctccatcatcctggcactttttaatgtgaatattaaaaggttgttgcatatatatcgttaaacgtttatgtttactttcacgttagctcgtttcattgatgtaaacatttagttttataacagcgtcgg 209|taattttattttttaaagtaaacagaccaaaatcaaaggtgtcttcgacaggtacgattattttcccattgacactgttttcgtgcacagatataattttatcaccgtttattattttgcccaaacacacgtactcgtttcttctcaagccaactatttctaaacaattcacttttctattatcgtgtacgcaattaaaagtaaacgaagcgctacaattgtcgtattctattacaattctgcggcatttataaaatttattaatgttgacgcaaattccatgcagcgcatccatttcgtactgcaaatgcggcgcaattaaaaaatttcctcgtcgttgttaacaatcttgggcgctaaaaagcacgccaacacgcccacgtctttaatgcaatattccaatttgaacggcagttcctcggacatgtatattgtcacggtgggcgccaaaggagcggctttagcaaaatgacacaagtaatcgcccgcaaaagtgtgcgttacggtttgctttgctttgagaacggaaaagttttcgttgtccgcgctcatctgcacgtccgccgagccaatgtcgccatttgctctaaactgcagacccttcttggaacacgacacaataatatcgtggtcgaattgcgtcatgtctttgcacacctgcgcaaactcgacgctcgacatgtggacgacgcaatcgtaatcgctatccggaattcccaaatgttccacgtcgatgcacatcaacttgagcgtgtacgtgcagattctattgtcgttgttgaacacgaacgccatcacatcgccctgatcttccgctttcatcagtacagagctgcgctcgttaacgcatttgacaattttacttaaactgtttatggacacgttgagcggcacgttgcggtcacatctatattttttgaaaccctcggcgtgtagttgcaacgacacgagcgcgacatgcgaggtgtccataacctgcatgcttacgcctcgattatcacaatcaaaagtagcgtgcggcagcagatccttaaaagtttccaccagcctcttcaaaactgcgccggttttaaattccgcttcgaacatttttagcagtgattctaattgcagctgctctttgatacaactaattttacgacgacgatgcgagcttttattcaaccgagcgtgcatgtttgcaatcgtgcaagcgttatcaatttttcattatcgtattgttgcacatcaacaggctggacaccacgttgaactcgccgcagttttgcggcaagttggacccgccgcgcatccaatgcaaactttccgacattctgttgcctacgaacgattgattctttgtccattgatcgaagcgagtgccttcgactttttcgtgtccagtgtggcttgttttaata 209|aattctttgaaaatattgtcgggtgtattattaaatagcatgtatggtatgttgaagatgggataacgcttggcgtgcgggtcgtcatgatttccaccgcgcaccacatatttgcgctcaattttatcaaaattggactggcgagacaaaaacgagacgggcgacaggcatatttgggcgtgcgtaccatcttcggccatccactcggtcaggtcttcgctgcggttaaacacacctttctgaccgtgaatgccacatatttttattccttccaaatcgttggtggacgtgactatgactattttaagcataacgttgtcgccgttaaccaccatgctggcgtcgagtttttcaattttttgatttttaatttgtctaaagtaaacgtacactttgtaaacgttaaaattgccgttggtgcacgtttcaattttgtaccgtcggccgtcgtacacccaattaatctttgcgttgctcaccaacacaccggccatgtacagcacaagtccgtcgtctagcgcaacgtaatttttgtcgctactattcgtaaactttactaaacacgactgcttggggccgaccacaagcttgcccttcaatttgttcactttgttgttgtataaacaaatgggcagcgcaatgtgcggaatgtacggatcttcggcggtcatgagtttattgtctcgcaccaacgtccacaatttaaacattttattgttgagcaaaatggacttgtttaccgccacagagtagccatttggtaaacccgatacgcaattttcctctttgtactcaaacacgggcatggcattctttagattggttagggacacaatcaatttgggtacgggcgtggtatgaaataaatgtataaaattacgataataatactgctccaacttggacatgagcgatttgacgtcatcgttttctacgatcgtacactgaataatgggattatagtatatagaatgtttatagtggtattcgtagggtgtcaacaatacgttaatgtcggcttcgttgttcacccgcaacttttttttgatgcatatcattccttcgtgatgattaacgtaaagtattctgtctgtaatcttcaattcgatgggcgccatgtttcttttcatagtgtacacgataaacgacgtgtttgattttaaacattttaaatttgtgggtctatcattaaacgcgatcagcaacgagtcgtcttgaacgtcgttgaggtcgtccacgaacgcgaccagattgtgttttagcaaatattgaaatttttgcgcaaccatttcgtagtccacgttgggcaaacatgcgttgcggcaaaggaaaaactttttgcccgccacggtcatttcgccgtgaaaaaaactgccaataaatttcacaaaatccttttt 209|ttgcttcaacattttctggcgcatgctgtcgttggtgattcgcgccacctcgttgccgacgcgatattttaacacgggcaacgaaatttcaatattgttattgctgctgttgtcctgttgattgggaaagactttgcgttgcttgctaaaagttttcgatacgcaatatatgagacgcccgttgactatacaatcgacaatctttttcgactctttgttgtacaagacgctttgaattttacgacgcttgttcgccaccgtgtacgcgtcgtcgtcggccgtcttgtcgagaactcgttgatagttttgcaaaattgtcgaagttaataacagttctatcaaataggcgtgcttgtatacaattttgttggccaaactgtctatagaatagtttatgtcgtgattcataataatttttatgtgttccacgagttgttgcttgtgaagcgtgttgtattcgaagagaaaatcgagcggtttccatttgccgctgttggccagatatgtttccagcacagaatttaaatcttccgtcactacgtaatcgctagcgtacacgtctcgagcaaacaggacgtcgtcttgtttgtcgtaaactagttggattgcgcgattgatgtgcttctcttgatccacgttgccgtacaaaaacatgcgtttgcaatgtttggcgtatagcttgtcgtagaaattgtgcaccaaaacgttgttgttcatcattatgttgggaaaactcaaaaatctgccgtccagcataaaagttccgttaatattgttgtttgcgtcgacatcgtccgtttctctaaattgcttgtctaagcgcgtgccgaatataacgggcacacatttatgcattacgcaactgagctgttcattaagagcgcaacacaaataagacttgcgttcttgaatagcgcaaaaaagcatacgttcattgctgtttgtagcgcaatcaaaagtatattttaatttgtatttattttcaattctatcgtacaactcgttgaaatcttgaaccacgtccgtcatcgtgaagcgattactgcgcactaattatgtctaaacgtgttcgtgaacggtcggttgtttcggatgaaacggccaaacgcattcgacaaaacgaacactgtcatgccaaaaatgaatcttttttggggttttgcaacttggaagaaattgattattatcaatgtttaaaaatgcaatacgttccggaccaaaagtttgacaacgattttattttaacagtgtacagaatggccaacgtggtgacgaaacaagttagaccgtataacagtatcgacgaaaagcaccattacaacacggtgcgtaacgtgttgattttaataaaaaatgcgcgtttagtgcttagtaatagtgtcaaaaagcaatactatgac 209|gatgtgttaaaattgaaaaaaaatacagacttggaatcgtacgatccattgattacggtctttttacaaattggcgaatctgtaaatgaagaaatacaaaaactcagaaaagctttggtcaatatttttactaataaacccgacaagtcggatataaacaacccagatgtagtttcgtatcaatttatttttggcagagtacaaaaattgtataacagggcaattaaacaaaaaactaaaactataattgtaaaacgtcctacaactatgaacagaattcaaatagattggaaaactctttccgaagacgaacaaaaaatgactagacaagaaattgccgaaaaaattgtaaagccttgttttgagcaatttggcactatattacacatatacgtatgtcctttaaaacacaaccgaattattgtcgagtatgcaaactcagagtcggtacaaaaagccatgactgtaaatgacgacactcgatttacagttacagagttttccgtggttcagtactacaacgtggccaaaacagaaatggtgaaccagcgaattgacataataagcaaggacattgaggatttaagaaacgctttaaaatcttacacataaattaaaatatcgaacaaaggaaaaaaacaattgtaacaaaaataatttacattaaaatttacaagtttttttctagtgtcgtacttttttacaatgcgtctgttgtccgtcgagcattgcaaacatattgtggacggcgcaaaatagcaaacaaaaggcacgtccgcgctctcccacgctattctaaaacgatgaatccatattaatttttcattgtcgccaaacgtcgctccgctgcctccttccaataacaaatactcagaaacacaaacatgtacaattgctgtcgcggcgttaattgtcgctgtttttccaaatagtctattatgggaaacaaacacttgtcacaacacaaatactcgttaattgtcacaaccgacaagcacatttggcaaaatgcgtcgcaatttttgtacggacgagattctatgcgaagttcgttgtccatgacgtcttgggtccactttttcaacaagacacttttatatttgtgatttgtacaactttggtacgtgttagagtgtttttgataagctttgataagtttaaaactgttggagtaaggccacgtcattatgttctgcaccttttgtttaaaagacagaaattactatatgttcaaactatttaaagattattggccaacgtgcacgacagaatgccagatatgtcttgagaaaattgacgataacgggggcatagtggcaatgcccgacactggcatgttaaacttggaaaagatgtttcacgaacaatgtattcagcgttggcgtcgcgaacatactcga 209|gatccctttaatcgtgttataaaatattattttaactttcccccaaaaacactagaggagtgcaacgtgatgcttcgagaaactaaagggtctataggcgatcacgaaattgatcgcgtttacaaacgcgtttatcaacgcgttacacaggaagacgccctggacattgaactcgattttaggcatttttttaaaatgcaatcatgacgaacgtatggttcgcgacggacgtcaacctgatcaattgtgtactgaaagataatttatttttgatagataataattacattattttaaatgtgttcgaccaagaaaccgatcaagttagacctctgtgcctcggtgaaattaacgcccttcaaaccgatgcggccgcccaagccgatgcaatgctggatacatcctcgacgagcgaattgcaaagtaacgcgtccacgtaacaattattcagatcccgataacgaaaacgacatgttgcacatgaccgtgttaaacagcgtgtttttgaacgagcacgcgaaattgtattatcggcacttgttgcgcaacgatcaagccgaggcgagaaaaacaattctcaacgccgacagcgtgtacgagtgcatgttaattagaccaattcgtacggaacattttagaagcgtcgacgaggctggcgaacacaacatgagcgttttaaagatcatcatcgatgcggtcatcaagtacattggcaaactggccgacgacgagtacattttgatagcggaccgcatgtatgtcgatttaatctattccgaatttagggccattattttgcctcaaagcgcgtacattatcaaaggagattacgcagaaagcgatagtgaaagcgggcaaagtgtcgacgtttgtaatgaactcgaatatccttggaaattaattacggcgaacaattgtattgtttctacggacgagtcacgtcagtcgcaatacatttatcgcacttttcttttgtacaatacagtcttgaccgcaattcttaaacaaaacaatccattcgacgtaattgccgaaaatacttctatttcaattatagtcaggaatttgggcagctgtccaaacaataaagatcgggtaaagtgctgcgatcttaattacggcggcgtcccgccgggacatgtcatgtgcccgccgcgtgagatcaccaaaaaattttttcattacgcaaagtgggttcgaaatcccaacaagtacaaacgatacagcgagttaatcgcgcgccaatcagaaaccggcggcggatctgcgagtttacgcgaaaacgtaaacaaccagctacacgctcgagatgtgtctcaattacatttattggattgggaaaactttatgggtgaattcagcagttattttggtctgcacgcacacaacgtgtagcatcg 209|ccagtatttaacagctgacctatttgttaaacaagcattcttatctcaataattggtccgacgtggtgacaattgtatccacaatcatgaaaaaagtagcgcttggaaaaattatcgaaaacacagtagaaagcaaatataaaagcaacagtgtgtcgtcgtcattgtcaacgggcgccagtgcaaaattgagtttaagcgaatattacaaaacttttgaagcaaataaagtgggccagcacactacgtacgacgtggtcggcaagcgagattacacgaaatttgacaaattggtgaaaaaatattgacatgctgcgatcaatcatgcgacgtttcaagagtacaaacaatctcagcaaaaaaccctccgattattatgtagtgttatgtccaaagtgttattttgtgacgtcggccgaagtgagcgtggctgaatacatagaaatgcataaaaattttaacacgaaattcgccgatcggtgccctaacgattttattgtgaccaactctaaaagttggaataatcatgaaaattgttctgccctattttaccctctgtgttaataaagtttgttgtttgtattttgtggttttatttatttacgctagatattgggtttaaggttcttagaaatagagttgtattttccctaccaaaagggatttgagcttcatataaatacaatattcgctcgacaagcggtttatttcactcggaggtattatatcaggcagtcgaacgtgcgcgatgaaacatcccgtttacgctagatatttggagtttgatgatgtagtgttagatttgactagtttaatatttttagagtttgataacgctcaaaatgaagagtacattatttttatgaatgtaaaaaaggcgttttacaaaaactttcacattacttgtgatctgtcgcttgaaacgctgaccgtgttggtgtacgaaaaagctcgcctaattgtgaaacaaatggagtttgagcagccgccaaactttgttaattttatcagtttcaacgcgaccgacaacgacaactccatgataatagacttgtgttccgacgcgcgcataatcgtggccaagaagctgacgcccgacgaaacgtatcatcagcgcgtgtccggatttttggattttcaaaaacgtaactgcatacctcggcccccaatcgagtcggacccaaaagtgcgagacgccttggatcgtgaactagaaataaaactatacaagtagaaaaaaattaatttattaatagttgtaataattatcttcgtcctcatcttcgctggtgtcataatgcggtggtgtgtttgtgttttgttttaatcgtttgcgcgtcgacaccacttcgccgataggaaattttttggatttcgcattaaatgccctcttagcgacg 209|cgccgtttacgactactaaacatgttgacgcgctcgtcgtcttcagtgtcataatccgtgctagtgttttcgttgttattttctatgagacgatcgtttgatttagttttcgtagaattgtccgcgttatcgtcgctttcgtcgatgtcgtccctaactatctcgtaggcggctttgcgcggaatccaagattttgcaatgtatctattttaacgtacttttcttcgagcgcttttctagctttatgcatagcaatgtcttcgtcgccgccgttcattttatgatactttgtaaacgtctcgacgaataactttttggcgcgaggaggcattttttcattgtataacatatcgggaatttgatacattgtaattagaattaagcaagttcgtcttcggttgtactgtattcggtttctgtatctgtagtggaatcctctgtactagtagtagtgtcgctattgttggcgtcaggccttggctgccatttaccgtctatcaacatgtattttttcctaacagcacaacatgctagcttggtagctatctgtgtcgacttatatttttgtaaactacgatcgtagaatttttcaaatatcctcttaccgttatagggaaggttttgataatatttaggcaacatatcaataaaagacaatataaaaactttgtgtttgtgttttatttatcacataaaatggacgtctggcaagaatcacaaccaatattagtgttttttttcttacattacgagattcaacttgatactaaaattaattattaattaaattaaattaaattttgaagcattttttcgctatcgttttcagactcaaaattatcgacgctatcgctatgaaaagcgtaatatttgttggctttgagatattctatattttgctcatttttaacaataaacacgcgactcttttcgtcgcgtctcaccataacaccgtttttacaaatggaaatgtatttgtaaaacggcaacagagcgtcgcgagtttttttaagtaacagcttttgctccgctgtggcggccacaaatatttttacgggcccgtcgtaattaatgtttaaattaaaatttttaagtcgacgctcgcgcgacttggtttgccattctttagcgcgcgtcgcgtcacacagcttggccacaatgtggtttttgtcaaacgaagattctatgacgtgtttaaagtttaggtcgagtaaagcgcaaatcttttttaaataatagtttctaatttttttattattcagcctgctgtcgtgaataccgtatatctcaacgctgtctgtgagattgtcgtattctagcctttttagtttttcgctcatcgacttgatattgtccgacacattttcgtcgatttgcgttttgatcaacgacttgagcag 209|agacacgttaatcaactgttcaaattgatccatattaactatatcaacccgatgcgtatatggtgcgtaaaatatattttttaaccctcttatactttgcactctgcgttaatacgcgttcgtgtacagacgtaatcatgttttcttttttggataaaactcctactgagtttgacctcatattagaccctcacaagttgcaaaacgtggcattttttaccaatgaagaatttaaagttattttaaaaaatttcatcacagatttaaagaagaaccaaaaattaaattatttcaacagtttaatcgaccaattaatcaacgtgtacacagacgcgtcggtgaaaaacacgcagcccgacgtgttggctaaaattatcaaatcaacttgtgttatagtcacagatttgccgtccaacgtgtttctcaaaaagttgaagaccaacaagtttacagacactattaattatttaattttgccccactttattttgtgggatcacaattttgttatatttttaaacaaagctttcaattctaaacatgaaaacgatctggttgacatttcgggcgctctgcagaaaatcaaacttacacacggtgtcatcaaagatcagttgcagagcaaaaacgggtacgcggtccaatacttgtacgcgacgtttctcaacacggcctcgttctacgccaacgtgcaatgtttaaatggtgtcaacgaaattatgccgccgcggagcagcgtaaagcgctattatggacgtgatgtggacaacgtgcgtgcatggaccacgcgtcatcccaacattagccagctgagtacgcaagtctcggacgtccacattaacgagtcatctaccgactggaatgtaaaagtgggtctgggaatatttcccggcgctaacacagactgcgacggtgacaaaaaaattattacatttttacccaaacctaattccctaatcgactcggaatgccttttgtacggcgaccctcggtttaatttcatttgctttgacaaaaaccgtttgtcgtttgtgtcacaacaaatttattatttgtacaaaaatattgacgcaatggaggcgttgtttaaatctacaccattggtttacgcgctgtggcaaaaacataaacatgagcagtttgcacagaggctagagatgttgttgcgtgatttttgcttaattgccagttcaaacgctagttatttactttttaaacagcttacacagctcatagctaacgaagaaatggtgtgcggagatgaagaaatattcaatttaggcggccaatttgtagacatgattaaaagcggtgctaaaggcagtcaaaatctgattaaaagcacgcaacaataccgacagactttaaatacagatattgaaactgtgtcttcacgagcc 209|accaccagtttaaatagttacatatcttctcacaataaggtaaaagtgtgtggcgccgacatatatcataacacggttgtgttacagagcgtgtttattaaaaataactatgtttgttacaaaaacgacgaacgtacaatcatgaatatttgcgctttgccctctgagtttctgtttccagaacatttgctcgacatgttcattgaatgataatataaatagagcgcatttgattgcatgcaatcagtgttttattaattttagagcaacatgtacgataaatttatgatctatcttcacttgaatgggctgcacggagaagcaaaatactacaaatatttaatgtctcaaatggattttgaaaatcaagtagccgatgaaatcaagcggttttgtgaaactcgtctgaaaccggcaatcagttgcaacactttaactgcggaaagtctcaatacgctcgtagacagcgtagtctgcaaaaatggactgttaaatccttacgccaaagaagtacagtttgctttgcaatatctttttgacgatgacgaaatatccaaacgagatcaagatggctttaaactatttttattacataattatgacaggtgtgaaaatatggaagaatattttttaattaacaattttagcatagcagactacgaatttgaagacatgtttgaaattgttcgtattgattgtagagatctgttattacttcttgctaaatataatatgtaattaaaattttgtttgttttattaaaatcctggattaaaaaatgacgaataatttgatttgcgtgcacgccaacaagattcttcgtcattatgatcaatgcgtgcatcaagtttatgcttttgtaattggcttctgaccactttagccatttgagcgtatctgcattcgtcgtctagagtttcaaacaccagatcggcgcaattataaaatccttcacccacgggatctatgcgctgccaacgcacatacattacaaattgatttgacctgtacggtattactacgggtatagaatagactagactgttgtcacataatgaatcgcccggatttggaattaaatttgaatcgttaccacctatgtattctaattcgttccaagttattggattgcgacgatcccagtttgatttagtaataaacacttcaaaataactgggctcgtgtatggctgttggacaaaaatgaacattcatctgataaaccggttgatagcgatttaaatatagcgtatttggcctccagttgttaaaaggttcgtccattccgcttttatcaccaaacacagaattgcgatcgtttgaaccggcaccgcaaagtgtgtgcggcacaaccctttgtttgattaggtcaaaatcgtcataattaggaccggccacagc 209|cgcgtattccatatactgttgaaacatgtattgcgctgtggaagcggccgccccggattctaaatcgagagctcgatatttataatagactgatttgtaagcattgcggcacgcggcgtcgggaatgttatcgccattgtcgggccaataaaagtttccatctttaaaacatttatattgacgggccgtcggcacggacaaatagccgtgagagcgcactgccggcgcgtgaatcgcagcaaacaatgcaattaataatgcaatcattatgattatacttatagaacactaatcggaataataaccgctgtcgtaatcttggtcaaaaacgttatgttgaaacataataacaccttacagtaacatacaataaaacaacatagtatcgtatataattataaactttattttttcattttatacaaacaaaatttatacgtattgttagcacattgagtgtcattttcgctgtctgaactatcacaatcatcgtcatcatcatcatcattgtcatcgtcgtcgtcacgtttgcgtttgacactgcattttttttggttaattttcactaacactggttcttttcgatcgtacaattgattctgcatgtacttttgcatgatcgcggtaaaacactttgcaattttatccttttgttcgtcgccaaatatttccagcaactcgttcataaatgtgcacaaaatgcccatgtgttttatccagctgattcgcattttcactggatcgaacaaacgcaaggggtacgctttttctgttaccttgccttcgatgtctatcaaaaggtacgggatacgatctccgttgccgggcacaaaatccgtgcctttgttaaccaaaatttctctacaatgcctagccaccgtaatcacgcgtcttttgggtgacggaccctcattatcgtcagttgatttgcgttttttgcccgggttatcgttataggtcatactaaagctgtagtcggtcaacgattttgatttggcaaactcatcatagtattcataaaaactagtctgtaaactttgcaaacatttgtccatgtccaaatgacgcaatatttgttccactgccgtcctaaacgcgattctcataaaaacgggcatatcctttttaactaaccaacccttgtatacgattttattctcactgttgagatagcaatattttttcttttttaatagtattaaaactttcattaaattttcaaatgccattttgtaaccgtccgtgaatgagttattaacgcgtgtctcaacatgtgtgcatatttgttttaatgtgtcggtttcgttggatatttcgttatagttaaatgtgggcaaaacaaatgtagaatctgtgtcgccgtacacaactttaaaagtgatgctgcccagattgaattt 209|ttctaaaatctcagggtcgttgctcaaaccttcaatcagagaaatggccagccgcaactgattgcgaccaactctagtgatgtagtttgcaagcactttgtaaaaaatgccataataaccgtatatgctattggcggtgcgcttcacggaattttgtttttgatcgtacagatcgtacaagaatgccgattcgctttgattgtcgcgattctttttaaatttgcacctttcgcttaacaattttaatagcaatttaacaactattgcacgcgaattgtggttcaaatacacgttgccgtcttcgcataaaattaaattggacaaacaagcacaaatggctatcattatagtcaagtacaaagaattaaaatcgagagaaaacgcgttcttgtaaatgcctgcacgaggttttaacactttgccgcctttgtacttgaccgtttgattggcgggtcccaaattgatggcatctttaggtatgttttttagaggtatcaattttcttttgagattagaaatacccgctgcggctttgtcggctttgaattggcccgatattattgacagatcgtttttgttaaaaaaatacgggtcaggctcctctttgccggtgctctcgttaatgcgcgtgtttgtgatggctgcgtaaaagcacgccacgctaatcaaatgcgaaatattacatatcacgtcgtctgtacacaaacgatgcaatatacattgcgaatatacagaatcggccattttcaatttgacaaacaattttatcggcaacatgcaatcctgcacgttgtacttggcaatcacgtccagccgtcgagtgttgtacatcttgaccatttcggtccaaggcaaatcgattttgttttcacccaaatagtaactactgattgtgttcaattgaaagttttcaactttatgctgattagaatcgctgctgaaaaatttatacaaatcaatgtgaatgtaatagttaaaataatacgtgtccactttgttgcccaacttgtttataaacagctttgtcgtcggcgccgcagccggcaaatcgtaacgctttaatagcattttggttttattcaatcgtccaagtatatagggcagatcaaatacgtctccgttaaaatccaaaatcacatcgggatttgtaatttttatcatgtcaaaaaacgctgtaatcatgtcgatttcattttgaaacatgaccacatacgtgtcatcgtcataggtctctggaatctgggtcggcagcttgtgatacataaaacaaaattttgcatactcgtcgtttttgtacaccacaaatcctatagacattatgcaatcaaccgatgctttcgacatgttgtggccgtccgaatgagtctcaatgtcatagcacgacaaaacgggcatgatgc 209|cgctggttaaagtcatttcatcgaccaactcaaagtcttcattaaaatgttgcaaattaaacatgcgcgtcgtcgatccaccgacatagttattttggcagcgttgtgttttcttgaatcgcatataggcgccttccacaaacggcgtttgcatgtgtacgcgattaacgttgtgaagaaacttgtccaaacacgccgcgttgtccgatggcgctgctttgtttctttcgtatttaatcacgtttatcttgttcaaataatttccttccacgcccggcgccacaaacgtggtgtagctgatgcacttgttgcggcaagacggaaatatgtgcttgtcgtagcattgtttgtaagaatacaaatttagttttactttaaagtaaaactgcagcactcgttctttgatatttgtattacaaaatgcaaacaagcaaccttgtttttcatcgtaatgcaaacgaatgatacgaaacgtatcggctgaagtaatattgaattctcctggttttgcatattctgcaaagcgcgttttgagttcattgtaaggatatattttcatttttaaatatgcagcgatggcccaaatatggaggcacagacgtcaacacgcgcactgtacacgatttgttaaacaccataaacaccatgagtgctcgaatcaaaactctggagcggtatgagcacgctttgcgagagattcacaaagtcgttgtaattttgaaaccgtccgcgaacacacatagctttgaacccgacgctctgccggcgttgattatgcaatttttatcggatttcgccggccgagatatcaacacgttgacgcacaacatcaactacaagtacgattacaattatccgccggcgcccgtgcccgcgatgcaaccaccgccaccgcctcctcaaccccccgcgccacctcaaccaccgtattacaacaattatccgtattatccgccgtatccgttttcgacaccgccgccaacacagccgccagaatcgaacgtcgcgggcgtcggcggctcgcaaagtttgaatcaaatcacgttgactaacgaggaggagtctgaactggcggctttatttaaaaacatgcaaacgaacatgacttgggaacttgttcaaaatttcgttgaagtgttaatcaggatcgtacgcgtgcacgtagtaaacaacgtgaccatgattaacgttatatcgtctataacttccgttcgaacattaattgattacaattttacagaatttattagatgcgtataccaaaaaacaaacatacgttttgcaatagatcagtatctgtgcactaacatagttacgtttatagatttttttactagagtcttttatttggtgatgcgaacaaattttcagttcaccacttttgaccaattgacccaata 209|ctctaacgaactttacacaagaattcaaacgagcatacttcaaagcgcggctcctctttctcctccgaccgtggaaacggtcaacagcgatatcgtcatttcaaatttgcaagaacaattaaaaagagaacgcgctttgatgcaacaaatcagcgagcaacatagaattgcaaacgaaagagtggaaactctgcaatcgcaatacgacgagttggatttaaagtataaagagatatttgaagacaaaagtgaattcgcacaacaaaaaagtgaaaacgtgcgaaaaattaaacaattagagagatccaacaaagaactcaacgacaccgtacagaaattgagagatgaaaatgccgaaagattgtctgaaatacaattgcaaaaaggcgatttggacgaatataaaaacatgaatcgccagttgaacgaggacatttataaactcaaaagaagaatagaatcgacatttgataaagattacgtcgaaaccttgaacgataaaattgaatcgttggaaaagcaattggatgataaacaaaatttaaaccgggaactaagaagcagcatttcaaaaatagacgaaactacacagaggtacaaacttgacgccaaagatattatggaactcaaacagtcggtatcgattaaagatcaagaaattgccatgaaaaacgctcaatatttagaattgagtgctatatatcaacaaactgtaaatgaattaactgcaactaaaaatgaattgtctcaagtcgcgacaaccaatcaaagtttatttgcagaaaatgaagaatctaaagtgcttttagaaggcacgttggcgtttatagatagcttttatcaaataattatgcagattgaaaaacctgattacgtgccgatttctaaaccacagcttacagcacaagaaagtatatatcaaacggattatatcaaagattggttgcaaaaattgaggtctaaactgtcaaacgccgacgttgccaatttgcaatcagtttccgaattgagtgatttaaaaagtcaaataatttctattgtaccacgaaatattgtaaatcgaattttaaaagaaaattataaagtaaaagtagaaaatgtcaatgcagaattactggaaagtgttgctgtcacaagtgctgtaagcgctttagtacagcaatatgaacgatcagaaaagcaaaacgttaaacttagacaagaattcgaaataaaattaaacgatttacaaagattattggagcaaaatcagactgattttgagtcaatatcagagtttatctcacgagatccggctttcaacagaaatttaaatgacgagcgattccaaaacttgaggcaacaatacgacgaaatgtctagtaaatattcagccttggaaacgactaaaattaaagaga 209|tggagtctattgcagatcaggctgtcaaatctgaaatgagtaaattaaacacacaactagatgaattaaactctttatttgttaaatataatcgtaaagctcaagacatatttgagtggaaaactagcatgcttaaaaggtacgaaacgttggcgcgaacaacagcggccagcgttcaaccaaacgtcgaatagaattacaaaaatttatattcattttcatcttcgtcatacttcaacagtcccaacacgttcatgttgtgattctcgccgttctcgacagttacgtaaatagttactttgattaaattatcttccagcagcattgagatttgattgaaatccgcacatagcttttgtagcgaatccgcttcggtttttttatttgtgttgacgtagaaaacagatttgttccatttgcccaagtcggaagaggtagaacagtcatccgaatcggcaatgttcaactcgtcgcttttaaactgcacaataaacttgttatcgcccatgtcattttcttccaattcgctttttaacacatttacattgtacgaagcaacgtgtttgttcgatcgactaatgttgatctttgcgtttgtgcaattttgcaaatttgaatatgcttcgctttctttagcctcgcacaattcgatgcgcgtagagttgaccacgttccaattcatgtacacgtttgatccattaaaaatttgttgacactttatactgtaaatggtaaagatttggttttcattgtcttttaaatatttaaacacctcattgatgtcgtcagacccctttatattgttcttgaatagatttattagtgttttcgcattgacagaacattccacttgaaccacgtcgggatcgtcgttgagatttttgtacacaacctcaaaaacaactttgtacaaaccgctgttgattttcttgtagataaatttgtactttacaataatattgacgccatcttcattttcaaaatgtttgttagtcaaatagtcgctcatgggggttgcagtttcaatttccatttcacattctttgtattcgttgatctgaatcatttgactaaactttgttttcacataatttaaactaatgtcatagcacttgccttcttccatgtctttgaaagattgcgaatcgccgtagtattcttgaattttgttgtcggacattattcgaaaagtgtaatggtattcattatcgatactcaacgtcattttgctcatcaatttaccactaatccttttgtaattttctctaatcttcttggggctactggccatagccatgcgttttataagcggctcaccgctactttctccagacaaagatcttttggtcgccatattgctgttgtcgatatgtgggaatctatccgatggcaaatactga 209|atggcgacgaaatcgaagtgtcgccagagcaccgttcgttagcgtggagggagttgattataaacgtggccagcaacacgccgctcgacaacacgttcagaacaatgtttcaaaaagccgattttgaaaatttcgactacaacacgccgattgtgtacaatttaaaaacaaaaactttaacaatgtacaacgagagaataagagcggctctgaacagacccgtccgatttaacgatcaaacggtcaatgttaatattgcgtacgtatttttgttctttatttgtatagttttgctgagcgtgttggccgtctttttcgacacaaacattgcgaccgacacgaagagtaaaaatgttgcagcaaaaattaaataaactcaaagatggtttgaacacgttcagcagcaagtcggtggtttgcgctcgctcaaaattatttgacaaacgcccaacgcgcagacctagatgttggcgaaaactatcagagatcgacaaaaagtttcacgtttgccgacacgttgacacgtttttggatttgtgcggcggaccgggcgagtttgccaactataccatgtcgttgaacccgctttgcaaagcgtatggcgtcacgttgacaaacaactcggtgtgcgtgtacaaaccgacagtgcgcaaacgcaaaaatttcacaaccattacggggcccgacaagtcaggcgacgtgtttgataaaaatgttgtatttgagattagcatcaagtgtggcaacgcgtgcgatctggtgttggcagatggctcggttgacgttaatggacgcgaaaacgaacaagaacgtctcaactttgatttgatcatgtgcgagacgcagctaattttaatttgcctgcgtcccggcggcaattgcgttttaaaagttttcgacgcgtttgaacacgaaacgatccaaatgctaaacaagtttgttaaccatttcgaaaaatgggttttatacaaaccgccttcttctcggcctgccaattccgaacgctatttaatttgtttcaataaattagttagaccgtattgtaacaattatgtcaacgagttggaaaaacagtttgaaaaatattatcgcatacaattaaaaaacttaaacaagttgataaacttgttgaaaatataacgtgtgtataaaaagccagcggcttcaaatcaggcatcattcaacatggattcgctagccaatttgtgcttgaaaaccctgccttacaagtttgagccgcctaagtttttacgaacaaaatattgcgacgcatgtcgctacagatttttaccaaaattttctgatgaaaaattttgtggacaatgcatatgcaacatatgcaacaatccaaaaaatatagattgtccatcatcatatatatcgaaaattaaaccgaagaa 209|agaaaacaaagaaatatatattaccagcaacaagtttaataaaacgtgcaaaaacgaatgtaatcaacaatcaaaccggagatgtttaatttcctattttacaaatgaaagttgtaaagagctcaattgttgttggtttaataaaaactgttacatgtgtttggaatataaaaagaatttatacaatgtaaatttgtatacgattgatggtcattgtccttcgtttaaagccgtttgtttttcatgtataaaaagaatcaaaacgtgccaagtttgcaatcaacctttattgaaaatgtacaaagagaagcaagaagagcgtttgaagatgcagtcgctgtacgcaacgttggccgatgtagatttaaaaatattagacatttacgatgtcgacaattattctagaaaaatgatattgtgtgctcaatgtcatatatttgcacgctgtttttgtaccaataccatgcaatgtttttgtcctcgacagggttataagtgtgaatgtatatgccgacgatctaaatattttaaaaataatgtattgtgtgttaaaagtaaagcggcttgttttaataaaatgaaaataaaacgtgttccaaaatggaagcatagtgtagattatactttcaaaagtatatacaagttaataaatgtttaattttaaggatattgttatggaataaactataaaatgaatttgatgcaatttaattttttgatactttccacagacggtagattcagaacgatggcaaacatgtcgctagacaatgagtacaaacttgaattggccaaaacggggctgttttctcacaataacctgattaaatgtataggctgtcgcacgattttggacaagattaacgccaagcaaattaaacgacacacgtattcgaattattgcatatcgtcaaccaacgcgttgatgttcaatgaatcgatgagaaaaaaatcatttacgagttttaaaagctctcggcgtcagtttgcatcacaatccgtggtcgttgacatgttggctcgtcgcggcttctattattttggcaaagccggccatttgcgttgttccggatgccatatagtttttaaatataaaagcgtagacgacgcccaacgccggcacaaacaaaattgcaagtttctcaacgcaatagaagactattccgtcaatgaacaatttggcaaactcgatgttgcggaaaaagaaatactggctgccgatttgattcctccgcggctaagcgttaaaccttcggcgccgcccgccgaaccgctaactcaacaggtctccgaatgcaaagtttgttttgatagagaaaaatcggtgtgtttcatgccgtgccgtcacctggctgtgtgcacggaatgttcgcgtcggtgcaagcgttgttgtgtgtgca 209|acgcaaaaattatgcagcgcatcgaaacattacctcagtaaacattgcaaacgactacgacattctttaaaaataagctatatataaatattgcattgtatgacaaaaaaattattaacctactgcaaagtaaaacttgtaaaaggcttttcaaaaaaatttgcgagtttattttgtcgctgcgtcgtgtcgcatctaagcgacgaagacgacagcgacggtgatcgctattatcagtataataacaattgtaatttcatatacataaatattgtaaaataaaagacatattattgtacataatgttttattgtaattaaattaatacaccaatttaaacacatgttgatgttgttgtgaataatttttaaatttttacttttttcgtcaaacactatggcgttgctttcgattagttttttcgttagcatttcatctaaaaaatcaaactgtttgcccggcgcgtttagggattctatggtgtagtcgggcgtgtcgctgtttagatattggtccacttcgcgcattatgtccaagacgttgttctgcaaatgaatgagctttgtcaccacgtccacggacgtgttcatgtttcttttttgaaaactaaattgcaacaattgtacgtgtccactatacaattcggcttaatatactcgtcggcgcaatcgtatttgcaatccaatttcgtgttcaacaaattggtgatgatatctttgaacgtgcacgttttcaatttgtccttatcggccaacgcaagtttcaattcgctctgtaaagtttctaaaattttgtctttattgttgtcaaattcgtgcgtgttgcgttccaaccacaatttgaacggctcgtcgacaaaaatgctgcgcaacacctcgtacaactgtctgcctaacgtgtacacttgctcgtattctttcatgctgacctctttgctaacgtacattactaaaaaatctacaagtattttcaaacatttgtaataggcgacgtattttgatttaagttttaaaccgtccaccgtgtattcgtccacgttcgcatcgaccacttttcgattattatcgccgcttgttgccggcgcgtcggcctgttcggttttaactatatccggttcaatatttaaagtttcaaaagatttaatggcattcataaaatcatctttttgctttggcgtggtcaatggtaaatctatcgaggagttgtcgtccgtgtgctcttcgggcacgctgttcagacgtaacgtaatctttttgggatcgtcttcatcgggtatcaaatcggctttaattttattagaattgagcaacgacatggtggtcgcttgtaaatttaataaattaattaaagactgaaattgtatattgcacaaatttattttcatttttattgatcttact 209|attaatacgctggcagttggtatgcttcatccatttttgtgactagaaaatttgctaaaaaactgagctcgtcctgtgttaaaacgttgtcgtccacgaatctatgcaatgtaaatgttacactgacattgtttaacaatgcatgtattaaaaaatcaacctgtcgcctactgagtttattagaagagtcgaccgtttctactagtttgtagattttgttattttcaatttcattgtttaaaaacatgttaactactcgtttgagtttaagcgaaaaatccttgtccggatagacttgttcgcacagccaattgctaagagtggttttgaccacggacaccttggtggtgaacgtcgtcgatttgaccagttcggtgaaaaagtttttcattaaattggacattttaacaaacacttatcaatctattgagctggtatttttgtttagaatcgcatcaagcgcttgctcgatctccaatttttttcggacgctcttagctttatgactcggtatgtcttctacggtagactcggtgttcttacttataatggccgggctgacgataataaacacgagaaacaatatgagcagatacaaaaagatgctgttttcctttttgtcatacactaggctaaatatggccagtgcgcccaacaacaaatataaattcatttttattcccttactctattcgttgcgatagtacaacaacgattctcccgacgaaccggacgaattgcgattatgctgcgcgtcgtcgtcgtcgttgttgttctcctcttcgctgctcgtttcgtctaaacctatattgtatttgttcaagtaatgtttggtgcttgcggaggattcgtggttcattaatttggccactttttgtaaaggcacgccgctattgtataggttactgctcaaataatgtcttatcatgttgctgcgcggccgttccatctcgacgcccgactcttcaaggagtcgcctgaaatctttgaagggcgtcgaggtgtttttagatatttgcaaaatggtcgggtttcgtgaataaatctcgcgtgccaattccaacggtttcattttgatgttgttgagtgtgttattacgactgcgttttcgctttaaattaatcgtgtcgctgtgcagttttcctcttttaattagcacgttgagatcgtccacgctgagttggcgcgcttcgttgattcgcatacccgtccctaacatgatgcaaaacactatcgcgcccctaattagaccgcggtcgtgaacataatcgctgttgagcattttaattttatcattaataaaatttaatatggtatctattacgtttttaagcattaaattcttttccttttccctgatatttttgagctccttgtcgcgcggcagcataaccatgcgg 209|ggaattttgtattcgggcaagttcatcatgttggtgtaaaagtttatagtcaactgtagtgtttctttggtgaccgagcgaagttcgagcatgcgcctgcacagttcttggggatcaatgagaagtgtttggttttctatcgagtcaaactccttgtccaacgagtacgacatgtcttccaggtgaacatcgtctaccgagcagtacacaattttaatgaatcgagacttgtaactttttaaagtggtgggcgcaaacggtttggggaacatgtacttgctccacagactgttgtttttcacctcgtcgggcgtgcatcgttgccgatcggtggccaaatcgaacacggactcgaaccggggagcggattgaatttttattttccaagaattaaaattgttttcgttgcgaacattaaaaccgttcattgtggttaatcaaatttattaaaaacaaaaggagaatcggtgtcaatactatccgaatattgttgttgttctcttaatattacgaaataatatattacatacagcagtaagaataaagctataaaagcgactacactaattaaaattataattcccgccgacacgttgctcgtcgtgttgtcatagcccaccatgtcgtttattggcattttgtgaacgggctcgctaaattgttgcggttcgctggcagtatcgtcgttgagcgccaatttcaacgggatgtattccaccttttcgtggttgcccaaccgatagtagggcacgtccaaattcatgtttacaacttatttgctaacaggaatttatgcaacaaaagtggtttggctttgatgagacgcaatttgaaatacttgctgcatttacgcttaagattgtattccatgcgggcggcggtgttgtagtcgtacgcgctcgcgctgtgatacacgagccgtaaattggttgcgttgcgcaaacacttggcgccttgtttgttcgaatgctgttttatgcgtctgttaagattgctcgtgatgcccgtgtacaattttccattgtcttgccgcagaatgtacacgcaccacaccttgttggtgtacagagtcgtcgccatgattatgcagtgcgccctttcgtgttcggccgagtggcgttaggcgcagccgcggcaataatcgcgttggcgtccttgttgtaatttatttgttgaaaaataaaacgtcttagagtttcgttttggaacgccaattcggtcaagctctcctggcaagcgcttttggtcaaatgagcggccggcgaattgaccgcgttggcggccgacgttaagaaggtggcgttctggaacatgctgggctgcttgccggctcgcgtcgccagctcggccatgtaattgaatatgttggcagacgcagatagcggcgccaaaaacgcaac 209|gttctcttttaaactcatgactcgcgccctgtttttttcgttcagcacgtagtggtagtaatcgccgccgccggcaaacagatcgtcaatcacggcgttgatcagatcgttgatcatgttgatgtgcggaaagcgacgcgactcgactgcgctctgtatgtttggcggcagagtggcgtgcttgagcaacagagtcatgtaattgttggccagctgctgattgaaaggtaacggaatgggaatgttgcacgtcaccgcttccgccaccatgtactggacggccagactgagttgtttggcggcctcggccaaagcgtctttgcccaacatatcagcgccaccgttgtaaaacttttgcgcgtacgccggcagcgaatttagcacaaacgatggctgaaatatatttgaatcgctcgacagggactcggccgcgttgctctgtcccaactctttttgcaaccgaatcaggtggcgtatcatggtttcctccgattcaaaccgctttaccacgtttacgctgattgggttcgtgtcgatgcacatgtcacgaatagtgtttataaaaagaatcatgagaggactaagttctgacatgtcattgcacctgtaatatctaataatcttttgaacaaaatccacacatttgttgtaccaaatagattcaccggcgtcgagcgtcggttctttgctcttgttgtacggtgcaatcgctaccgagtttgtgctgttgctgcggctcgtgtaatccatcctgttgtcgcgcgtggcgacggtcgtaggcaccgtcgccggcggcacgtacccgggcgcgttgtaagtttgcgcgctggtgaatatggccgttgccggattagagggatacctcagcggcggaggggtgttgtaataaaaattgccacgttcatctgtcatactttttatttgtactcttatgattacaaaactcaatatacggattacttataatatagttgttgtgacaaaaaagcgataataaaattaacaaaattatcaacaagttaatcatggaaaatttttcaacgttgaataacaacaacaaaatggcgcaggtcaacagcaccgtttgaaaactgacgcgccgacacaaaatgctttcgcaatttctaaaagccacattaaacgaattttcacctttgatataatcacgcagttcttttttacaacattcgtcgcacaaaattaacacctttataatgaggccgtcggtgtgtatcgtttgaaatgtccgcggttgactgcctggatgaaattcaaacgagtacccagtggacacgtgtatctgtgcaaaataatgggctaatatcgaggcgcccgtttttttaacctttacttttgatattttaataacattaatgttgttatttgcgtaatcagagttt 209|ttattgtggtgatcatcgtacaaataatgaagcaacagttcactatcgtatttaatcttgtttagcgttgtcaagtttttgtttcttaggcgttggagcgtctccgtcgtcgatattttcttcgaaatcgagtccaacaacgtcggcgtttccttcttgctcatcgatagcggcggcggaggcggcctctccgtcgtcgtcattcgcggtttctacagtgcgtttgggcgacgacgtgtgtacagcagcgtccgtcttactattatcggaccgccaaatttttgtttgaaataacatttggcccttgttcaactttatttcggcgcagttaaacattattgcattaagatcatattcgccgttttgcaccaaattgcacaaaacaccatagttgccgcacgacactgtagaataggcgtttttgtacaacaatctgagttgcggcgagctagccaccttgataatatgggcgccaacgccccgtttttttaagtaatattcgtcttcaattataaaatctagtacgttttcatcttcactgttgatttgggcgttcacgatgatgtctggcgtaatgttgctcatgcttgccatttttcttataatagcgtttactttaatgtatttggcaatttattttgaatttgacgaaacgactttcaccaagcggctccaagtgatgactgaatatgtgaagcgcaccaacgcagacgaacccacacccgacgtaataggctacgtgtcggatattatgcaaaacacttatattgtaacgtggttcaacaccgtcgacctttccacctatcacgaaagcgtgcatgatgaccggattgaaatttttgatttcttaaatcaaaaatttcaacctgttgatcgaatcgtacacgatcgcgttagagcaaatgatgaaaatcccaacgagtttattttgagcggcgacaaggccgacgtgaccatgaaatgccccgcatattttaactttgattacgcacaactaaaatgtgttcccgtgccgccgtgcgacaacaagtctgccggtctttatcccatggacgagcgtttgctggacacgttggtgttgaaccaacacttggacaaagattattctaccaacgcgcacttgtatcatcccacgttctatcttaggtgttttgcaaacggagcgcacgcagtcgaagaatgtccagataattacacgtttgacgcggaaaccggccagtgtaaagttaacgaattgtgtgaaaacaggccagacggctatatactatcatactttccctccaatttgctcgtcaaccagtttatgcagtgcgtaaatgggcgccacgtggtgggcgaatgccccgcgaataaaatatttgatcgcaacttaatgtcgtgcgtggaagcgcatccgtgcg 209|cgtttaacggcgccggacacacgtacataacggccgatatcggcgacacgcaatatttcaaatgtttgaataataacgagtcacaactgataacgtgcatcaaccggatcagaaactctgacaaccagtacgagtgttccggcgactccagatgcatagatttacccaacggtacgggccaacatgtattcaaacacgttgacgacgatatttcgtacaacagtggccaattggtgtgcgataattttgaagttatttccgacatcgaatgtgatcaatcaaacgtgtttgaaaacgcgttgtttatggacaaatttagattaaacatgcaattcccaactgaggtgtttgacggcaccgcgtgcgtgccagccaccgcggacaatgtcaactttttacgttccacgtttgccattgaaaatattccaaaccattatggcatcgacatgcaaacctccatgttgggcacgaccgaaatggttaaacagttggtttccaaagatttgtcgttaaacaacgacgccatctttgctcaatggcttttgtatgcgagagacaaagacgccatcgggcttaacccgttcaccggcgagcctatcgactgttttggagacaacttgtacgatgtgtttgacgctagacgcgcaaacatttgtaacgattcgggaacgagcgttttaaaaacgctcaattttggcgatggcgagtttttaaacgtattgagcagcacgctgaccggaaaagatgaggattatcgccaattttgtgctatatcctacgaaaacggccaaaaaatcgtagaaaacgaacattttcagcgacgtatattgacaaatatactacagtcggacgtttgtgccgacctatatactacactttaccaaaaatatactacactaaactctaaatatactacaactccacttcaatataaccacactctcgtaaaacggcccaaaaatatcgaaatatatggggcaaatacacgtttaaaaaacgctacgattccaaaaaacgctgcaactattccgcccgtgtttaatccctttgaaaaccagccaaataacaggcaaaacgattctattctacccctgtttaacccttttcaaacgaccgacgccgtatggtacagcgaaccaggtggcgacgacgaccattgggtagtggcgccgccaaccgcaccacctccaccgcccgagccagaaccagagccagaacccgagccagaacccgagccagagttaccgtcaccgctaatattagacaacaaagatttattttattcatgccactactcggttccgtttttcaagctaaccagttgtcatgcggaaaatgacgtcattattgatgctttaaacgagttacgcaacaacgttaaagtggacgctgattgcgaa 209|ttggccaaagacctatcgcacgttttgaacgcgtacgcttatgtgggcaatgggattggttgtagatccgcgtacgacggagatgcgatagtggtaaaaaaagaagccgtgcctagtcacgtgtacgccaacctgaacacgcaatccaacgacggcgtcaaatacaaccgttggttgcacgtcaaaaacggccaatacatggcgtgtcccgaagaattgtacgataacaacgaatttaaatgtaacatagaatcggataaattatactatttggataatttacaagaagattccattgtataaacattttatgtcgaaaacaaatgacatcattccggatcatgatttacgcgtagaattctacttgtaaagcaagttaaaataagccgtgtgcaaaaatgacatcagacaaatgacatcatctacctatcatgatcatgttaataatcatgttttaaaatgacatcagcttatgactaataattgatcgtgcgttacaagtagaattctactcgtaaagcgagtttagttttgaaaaacaaatgagtcatcattaaacatgttaataatcgtgtataaaggatgacatcatccactaatcgtgcgttacaagtagaattctactcgtaaagcgagttcggttttgaaaaacaaatgacatcatttcttgattgtgttttacacgtagaattctactcgtaaagtatgttcagtttaaaaaacaaatgacatcattttacagatgacatcatttcttgattatgttttacaagtagaattctactcgtaaagcaagtttagttttaaaaaacaaatgacatcatctcttgattatgttttacaagtagaattctactcgtaaagcgagtttagttttgaaaaacaaatgacatcatctcttgattatgttttacaagtagaattctactcgtaaagcgagtttagttttcaaaaacaaatgacatcatcccttgatcatgcgttacaagtagaattctactcgtaaagcgagttgaattttgattacaaatattttgtttatgatagcaagtataaataaccgcacaaagttaaatttttttcatttacttgtcaccatgtttcgaatataccctaataacacaactgtgcccggttgtttagtgggtgacattattcaagttcgttataaagatgtatcacatattcgctttttgtcagattatttatctttgatgcctaacgttgcgattgtaaacgaatatggacctaacaaccagttagtaataaaacgcaaaaacaaatcgctgaaaagcttgcaagatttgtgtctggacaaaatagccgtttcgctcaagaaaccttttcgtcagttaaaatcgttaaatgctgtttgtttgatgcgagacattatattttcg 209|ctgggtttaccaattatttttaatccggctttgctacaaagaaaagtgccgcagcgcagcgtgggatatttcatgaattcaaaattggaaaggtttgccaattgtgatcggggtcatgtcgttgaagagaaacaattgcagagtaatttgtatatagattatttttgtatgatttgtggtttaaatgtttttaaaataaaagaataacaatttacacattgttttattacatggataatgttgtttgtttgacattaaaggttatcatggtgcaatgattaataataaaacaatattatgacattattttcctgttattttacaatataaaatcacaccaattgtgcaaagttttattatttgtttgtcgacggtcgaggggtcagcggcgtgtgcaacaataaaaaacatgaagctgttaacaattttgattttattttattcattttttatgaatttgcaagcgctaccagattaccatcaagcaaataggtgtgtgttgctgggaactcgcattggatggaacgatgacaatagccaagatcccaacgtatattggaaatggtgttaaataaaagtgaatatattttttataaaattttttatttaaaattccaagtaatccctgcaaacattaaacactgtaggtatttttaaatcttgccacatgcgaacaacgcacggcctgtcgtcgaacaccgctattacattatattttcctctgatatagttgttaaacaattttaattttaataaataatctttacaagtatcgtctgaaggcctcataaacaatttatatgatttaatatcaaaatacttttcaatccagtttcgagtgggctgttcacaaattacgcttctcccgctcataaacacgataattgcgtcgtggcaatttgccaaatacttaacgcaagtaataacgtctaagcgggcttcatcttgagcaactctattatcaaaatcataaaacgatctatttgtgggcaaagctactgtaccgtctaaatcacataatacagcgcggggaaatttgtcgccgacaggaacgtaatattcgaaattatttacctttagaaactttttatattgctttttaatagtttctggatttaatggaaatttatcagagcgtttataattgcgttcaagagccgtttccaaagaaacgtccatcaaacgcgttaaaaaatggtaattatgcgttgcggccattttttgccacatgtccaccgattgagtgttcaaattagtgtcgctgacaaccacgttggcaccacattttgcggcttttaaaaactgttcaatgcacattttggtaatttgttcttctttagtttgtctacatttccgcgattggttatagaaagcgttcagttttgtataatcgccgttta 209|aaaacaacttaacgcgcacgtcgtctctgttgatttctgtatagccttttaaacttttggcatacgtgcttttgcccgaacccgaaatgcctatcaacaccaacaattgttttgaagaaggcaatttaattgttggagcaagtttattatttaatgcctgcttagtcgatacaaattttataatatttttgatcattttaattttttcaggctcggttaattttaaaaattcgctctccacatcgatcgtttgtgctttacgacatctgtacgctaaacatttccacggcaaagtttgcaccagttcgttgaaacgctgttgattcaaagtcaaacccgacaccataatatttattgtagactcgttggtgaacgtgtttctagcatcaacgtacggtttaatgacactttttaaatgcgggaaaagagctagaaagtcatcgtgttcgccatttataacaagctgcgccaatttagtaggattttcagcacggctctgatttttgtgcatgttcaaatacacgtcgcttttaatcttgcatagtggcgcgttgtttttatcgtaaactacaaatccttcttccaaatttttcaactgggccgcgtgttcgacacattcttgcacagacgtaaactcgtaacatttggggtatttgcaaaacggcaaattggaacagtaaaaataatcgcccgtttcgttgtttctgcttgccaaataccacaacgttggctgttcatcgtaaacggttacaattctgttgtgtttgcttgttaactcaaacatgtgagtcgacgcgcagtctaaatattcgttacacaacgcttgaaattgattgtgggcctcgtcaagttgaagagcttgcaaaactaaacgtttaaacgtcacgtctgacacgcaaaggttttctgcaaaagcacttcctcgggtgctggcatgccattcgccgttgtacttgtagattttaattaaacttccgtcgattttttcgtaaaacttaaaattctccttcgattggaacagtttgtgatgagcatcttcgccgccgatattttgtagcaattcttgaaaattaaagaaacgatcgaaagaacgcgacacaacggcgtacgtgcggctgttaagaattaaaccgcgacattccacgaccacaggatgatctcgatcgcgttcaaacgattcgtaattaagaaccatcaaatcgtgttcggtataatttttaattttgactttaaacttgtcacaaagatttttcactccgccgtttgcaagtagacgcgaaacgtgcaacatgattgctgtttaataatgcataccaatgctaaactgtctattatataaagtgcagtgataactttgttatcaacgcgttcgatgccgacatatataaacgcaatgtaac 209|agtttttgctagtaccatcgcatacaacattatgaatacaaggggttgtgttaataataataaaatgatatttatgaatgctttgggcttgcaacctcaaagtaaattgaaaattattgcacataaaatactagaaaaatgtaaacgtgacgcgtacacgcgtttcaagggcgtaaaggcgatcaagaatgaactaaaaacatacaatcttacgttgcaacaatacaacgaggcgctcaatcagtgcgctttaaacgatagccgatggcgcgacacaaataattggcatcacgatattgaagaaggtgtgaaaataaacaagagacatatatatagagttaattttaattctaaaacccaagaaattgaagaatattattacattaaagtagaatgttatgtaaacagttaattaatctacatttattgtaacatttgtggtaatagtggcgttggttatacatttatatgattgtaatgttgtgtactcgttttgtaataaatttttgtgtttaatcaattcaatatttttatttgataaaaccttattttcgctactcaatttggcgtttttagacgcaagttttgcgtaatcgtcattgagcgattttagcgccttttcagttgtaattcgtttcagttgcaattctttaaaagatttatgcatgttgttgtagtcgcttttaattttgtctaacttttcttgcatagaaacgcttgtttgttgtaatttgtctaaatctaattgttgtttaatgttgagctgcgtttgttcggcaatgtctacctgtagtttttttagtatcgcttgtgcttcagacagcatagtgtcgtcggcatttgcgttgttgtcttctgcgtcgtccaacagacttttttcaaacaacacactggccaaagaggccgcatcaaaattagcgtttattttattccattgtgcgacactcgacgcgctgcatttaatcacatccacaacgtttcggtttacgctgtaaacgttgaaatgcaaactttcaaccctacacaagggacatggtactttttttcgttttctaatcttgcgtatacacattgagcataattgatgtttgcacgtgtctagttctaatacgggtattatagtcaatctgtctattggttgcagaaaataatttttaatttctgcaaccgaaaaacaaatgttgcattgcaatttaacaaactccatttttagacggctattcctccacctgcttcgcctgcaacaccaggcgcaggacctgccactgcgccgccgcccagagtagcgttaggatttgctcttggtataaagtcgttgcgcaaaaagttgttttctgaattgattatttggtatcccaaaaacagcggaacgtacgtcgggtattcttcgtatccgctaa 209|gcgttctgtccagctcacgtgtgtcgccttcaaatttcaaaacgtttctaatttgcaaacgattgggttgacttctcataatgtcactgcttcttatcgggttgtacaactcggggccgtcgggcacagacgcgaccagacccgtttcgtcaattatacacgtggcgcaatttctaaacctcaattcctccgtgtcgatttgcaagtactcgggcgctactgcgcgtcgaatcaaattttgcaaaaatccactgtaattgttaaataattgatcgccagcaccgcctcgaagcgctcgggcgttggtcacgtcaaagaaacgcaattcgtctcgcgacacccgcgaacaaaacgtgttcgggtttgtggtgtccagaatgctttttgtagttgcgtaaacgctgtgtataacgcgttgcgtgttgcttgtgaaaccttcggtatattttagattgtcgcatatagtgttaactgcgttttcgttgttatatatcaaatgaaagattagctgttcggcttgcatcatactgtttagattaaacacgtcttggtaattggttgcgcttggaattaaaattcgcttgatacctctttctttatttccaactaaatgcctagcgatcgtcattttgaattgattgtcgtcttcgtcgaaaatgggcaaaaccatttttgacattttaaaacgttttatgaggtggttgttgcaaataaaccatccatcgtcatgatacgcgtcgggcgaacacggcgatttgtatgttatgcacgcgtcgaacgacacgatggacgcgaaaatgcagcgattaactctcatttgtcgcggcgccatacccacgggcactagcgccatattgttgccgttataaatatggactacggcgattttgtgattgagaaagaaatctcttattcaataaattttagccaagatttgttgtataaaattttaaattcttatattgttcctaattattcgctggcacaacaatatttcgatttgtacgacgaaaacggctttcgcactcgtatacctattcagagcgcttgcaataacataatatcaagcgtgaaaaagactaattccaaacacaaaaaatttgtttattggcctaaagataccaacgcgttggtgccgttggtgtggagagaaagcaaagaaatcaaactgccttacaagactctttcgcacaacttgagtaaaataattaaagtgtacgtttaccaacacgataaaattgaaatcaaatttgaacatgtatatttttcgaaaagtgacattgatctatttgattccacgatggcgaacaagatatccaaactgctgactttgttggaaaatggggacgcttcagagacgctgcaaaactcgcaagtgggcagcgatgaaattttggccc 209|gcatacgtctcgaatatgaatttgacgacgacgcgcccgacgacgcgcagctaaacgtgatgtgcaacataattgcggacatggaagcgttaaccgacgcgcaaaacatatcaccgttcgtgccgttgaccacgttgattgacaagatggcccctcgaaaatttgaacgggaacaaaaaatagtgtacggcgacgacgcgttcgacaacgcgtccgtaaaaaaatgggcgctcaaattggacggtatgcggggcagaggtctgtttatgcgcaatttttgcattattcaaaccgacgatatgcaattctacaaaaccaaaatggccaatctgtttgcgctaaacaacattgtggcctttcaatgcgaggttatggacaaacaaaagatttacattacagatttgctgcaagtgtttaaatacaaatacaacaatcgaacacagtacgaatgcggcgtgaacgcgtcatacgctatagatccggtgacggccatcgaatgtataaactacatgaacaacaacgtgcaaagcgtcacgttgaccgacacttgccccgcaattgaattgcggtttcagcaattttttgatccaccgctacagcagagcaattacatgaccgtgtccgtggacgggtatgtcgtgctcgacaccgagttgagatacgtcaaatataaatggatgccaacaaccgagttagagtatgacgccgtgaataagtcgtttaacacactcaatgggccattgaacggtctcatgattttaaccgacttgccggagttactgcacgaaaacatttacgaatgtgtaatcacggacacgacaataaacgtgttgaaacatcgtcgcgaccgaatcgtgccaaattaaagcacgttaagcggatacaacgggcagtccgagctgttaaagtcaatacaaccatcgttaacaaacgaatacgcattgttgtgacagctgaggatataaaaaggaatagagaagtaattgcaatgaaatatcccgttacaattccacggcacagcgtatgttgctcgagttctatcagttgcacacaacggcctaagaaaatttattaatgcttcatttgtatctatattagaaggataatacataggttcgcccaaaggactgggagaaggcggcggcgaaggtgtaggtgtaggaggaataggagaaggcggcggcgaaggtgtaggtgttggaggaataggagaaggcggcggcgaaggtgtaggtgtaggaggaataggagaaggtggaggtgtaggtgtaggtgttggaggtataggtgttggaggaggtgtaggtgtaggtgttggaggtataggtgttggaggaggtgtaggcgaaggtggagaaggtgtaggagtaggtggaggtgtaggtaacggtacaattggt 209|ggagatgtaggtggtggtacaattggtggatttggatacaattcctgaatgtcgtctaatatttttaaagttaataaaattattataaataaatttaatattattattattattattatcacaataatgtaccacatgttgcttaaatataaaaattaaacaaagaatgttgtattattgcaaatttaacaattttttgtattctccccatgtcatgcgttcgtaatgagcgggcggttttttatttctttgtatccacttgtaatcgttaatgtggttgtgaaaagtcatactgacgtaggccattaaatttttcatgagcatattatttgacacaactgcaacatctgcgcctgccgtttcttgctggtacgaatcgacaaacgtaatgtctgtgccgtatttttctttgtcaagtgcaatttctataagctcaatgtggtaaatgatgaaacctttgacgttcatataatgatcgcggcacatggcgcactgtagtatgaaaaatacgttgtaaaatagcaccttcattgttttcaactgctgcatgacaaaatctaaactgcttttgtctcgcgtatacaccatatcgtcgatgatgagactgagaaagtgcatggtgtcccatatggtagtaaacgtgtaagtaaaactcttgggctggcacgaacgcaaattgagttctgtggttttgtccataaattctatgcgaaactgttgcaagtccatgtcgggggatgcgttaatggcccattcgatcaactgctgcacctcgtacttttgaatgtctttgtatttcatcaaacacgcaaaatggtataagtaagttgcttgcgaagacaacagtttggtgaggtgcgtcgatttagaggctcgcaaaaggtctatgagacgaaacgaatacaacagatagctgtctttgtaacgagaaaaaagcggcgtcagcggtatcatggcgactagcaaaacgatcgtgctgtacttgtgtcaggcgccggccacagcgtcgttgtacgttagcgcagacacggacgccgacgagcctattatttatttcgaaaatattacagaatgtcttacggacgaccaatgcgacaagtttacttattttgctgaactcaaacaggagcaagccttatttatgaaaaaagtatacaaacacttggtgcttaaaaacgagggtgcttttaacaaacaccacgtattgttcgatgcaatgattatgtataagacatatgtgcatttggtcgacgagtctgcgttcggaagcaacgttatcaactattgcgaacagtttatcacggccatttttgaaatttttacgctcagcagtaaaatcgtcgtggccgtgcccgtcaattgggaaaacgataatttaagtgtacttttgaaacatttgc 209|acaacctaaatctcattggaattgaaattgtaaattaaaacaaatcatgtggggaatcgtgttacttatcgttttgctcatactgttttatctttattggacgaatgcattaaatttcaattccttaaccgagtcgtcgcccagtttagggcagagcagcgactcggtggaattagacgagaacaaacaattaaacgtaaagctgaataacggccgggtggccaacttgcgcatcgcacacggcgataataaattgagccaagtgtatattgccgaaaaaccgctatctatagacgacatagtcaaagagggctccaacaaggtgggcactaacagcgtttttctgggcaccgtatacgactatggaatcaaatcaccaaacgcggccagcacatctagtaatgtaaccatgacgcgcggcgccgcaaactttgatatcaaggaattcaagtccatgtttatcgtattcaagggtgtgacgcccactaaaactgtagaggacaatggcatgttgcgattcgaagtcgacaacatgattgtgtgtttgatcgaccccaacacggcgccgctgtccgaacgagaggtgcgcgaattgcgcaaatctaattgcactttggtgtacacaagaaacgcggcagctcagcaagttttattggaaaataactttaccgtcattaatgctgaacaaaccgcctatctcaaaaactataaatcatacagagaaatgaattaataaaacaaaaagtctatttatataatatattatttattaacatacaaaatttggtacactagtgttcaaatcgtttctgttcaacgccattgtcatgttataaaacacatttgtagttttattgtaattatttttaaatttatttttaatttgctgtaataaaacttgttcattaaatacaaaagactttgaactacttgcgtttatattctttttataattgtactgaacaaacgaggggtgcaaaaagtttttgaaatgctgcacggcaatacctatcatctcctccattttgtcctctcctattgtaatagtggcactgcgcaccgttttaatgtttagaatgtaaatgagcgcatacagcggactattgttggtgctcaagcacattaggttgtgcttatgcatagggtcgttgctcagcagcgttttgtatactacaaagcccgttttggggtcgcgtctgtacattagtacgtgcgacaaaaacaaacgcaccggcgtcacaagcgactcgtaatacatgctttctatcggaaactgtttggacttgatgtgttcgtacacggagccggcaaacttgacgctgtctacaaacttatggttcgtgtaaacaatcaaaaatctgtcttgtacaccgtcgtcataatcgtccacgtacagcggc 209|ttgttgttaacaattaacattttgtagttggcttcatactttagcagcccttggtattttctgctcttggaatcgctcttgctcgaatcggcatgcttcttaaagtacgactcgctgcattgtttcaactcgttgatagtgtacaactgcgagttgagtttgctcacttccttgtcgctcgtttccttgttggactctccgctgtggttgtcatcgtcaaacttgtgcatcaacaccaaatagtccaacagctcaaaaaacgacgacttgcccgaacccggttcgccgggcatgtaaatagccttctttccgtaatctacgggaatggccaaactagcggcgaaatgcatcaacataatcgcgttcgcgtgattaaaattggtgaagcgtttaaagtacaaatagccttcgacaatctttttcaaataattgtacgagtactccttcaagtccactttggacatgatgatgcgcatgtagaatcgagtcagccaagtgggcaaatcgtccgtgctgcgcgccaatatgattttgtcccaccacacattgtacttcttcaagatcattaacgcgtcggcgtggtgcgtgtaaaatttggaaatgttatccgattcttcaaactgaacatcgggttcacgtgcaacatcatcgcgcaattcggttaaaaacaaacgtttatcattaaacttgtccatcaacatgtcgacatattcgattttgtgaattgttcgatacaagtactgaataattttgttgtgttctttggaaaaaaactctccgtgttggttaacaaattcgctgttcgtgcgaatcaacgtggtcgacacgtacgttttgttagtaaaaattagcatccaaatcaattcgctcaattctgcatcgttaccgaacatgtccgccatcaagcagacttttagcgcttttctattgatctttattttcttgtagcatttgcattttggtcgagatcccgataccgttgaccgacacggtttgcattttaggttgtgcaacatgtcggaaaccctgttcttgtttacgtacagagcgagcgtaatcagattttcatcgtccaaattccacaaatcgcgaaacaggttgtttaacgcgactcgcatatcggcttggcatgtgttgcaattgcccatgtagttaactatggccgtgttagtttttagcatttttacatctcggcacattttggcgatgtgataagttctataaatgctgagctcgtcggcgctagtagatagcatgtaattaaacgcgtcctcgggcaaatacttttcgtcggtgggcttcttgaatgtctgcggcaacgtggtgcccaacaaaaatggacagctcgaatgaaagctgttggtgaacacgttgtacacaccgtgcgttgtcaagtacaa 209|gtatttccaattgttaaattttatgttgctcaacttgtaacaattgcttttggtcaatttgaataggtcatcctctttctttacaatttgataatgtttgccgttgaaaaccaaattgactccggtcactacgttttccaattttctaaagaatcctttacacacaatgtcaggcggcaagtttagcgccatcacattctcgtacgtgtacgcccacaattcatcgtgatccaaaatttcgtttttagccgactgagtcaaatatatcatgtagtgtatgccaaaataatagcccaacgatacgcacaatttggtatcgtcaaagtcaaaccaatgattgcaggccctattaaacactattttctcttgttttttgtaaggctcacatcgcttcaaagcttcattcaaagcttctttgtcgcaggcaaataatgattcacacaaaagttccaaaaacagtttgatgtcggtttctctgtacgagaaattttcgttcttggtcaatatcttccacagtacatagattaaaaaatcaaaatttttaaatttgcttttttcaaagtattgttgtagaaggtttggatcgttggctcgttcgtgggtcgccaaaactttaaccatgttctcgtgaattgctataagccccaaattgatttgcgtttgaatgtagtctgcattttcgctgctcgccgatataatgggtacgatgcgcggttttctggaacgcgtgtcgctcaagtccacgtcgtttttgtcaaaattgttgttctcgaacactctgaggcttttgaggttgacgttgacgatatgcttgtacttgggcaccgtaatgcattcctccaaattaatgtcgtccctaatgtaattgaaaaaatttttatccgaattgaccagctcgccattaactttgcacgtggccacagtgccgtcggccattttgagtataaacaagtcttcgtgagaatcgtcaaacttggtttttccatttacaaacagcgtttgcggcggatcgtgattcgtgcgcaggctgagctcgacgttgagaaaacatttagggtcaaacacaaacaaatccacagggcctagttttttgttgtgtatgattggtatcgtgggttcgatgacaattccaaattttatatttaaaaacagctgccatccgttaaaagagaaagcttgctttttgggccagttgggccaataatagtaatcgcccgcttgcacgcatttgttaatgtatccagggtcggtgctcttgaaaaaatcttcaaaattaatatacttttgtatgatgtcatagtgcttcttcaaaatgaaaggttttacaaaaatgcaaaaatcgttactttccaacacccagtcgtggccgtctaatgtttgagctgcgtgtttctctgcag 209|gttcttcggtgtcttcgcaagatgcgcccatgtcgtgtttcgcgcacggaccgttaaagttgtttctaattgtgtttaagaactgttgaaagttgttgacgtactcaaacaatctacgtgttcctgttcgcgtgtttctaatgattaaatgatttgcatcttgcaagttgttaatctcgtacgttttgtcttgaggcacgtttttcaaaaaaaattgtaaaatgttgtcaatcatgttggctatcgtgtttgtacttttcgtgttaatttatttaataatttcgatcaaaaatcaccatccattcttacatagaatagaaacgctaatacaagatttcaacaacacattgttgtttggcgcgtatgtacagatttacgatttaagcacgcccgcccgcaccgaacgattgtttattattgcgcccgaaaatgtggtgttgtataattttaacaaaacgctctattattacttggactcggcgaacgtgttttgtcccaacgagtttagcgtgaccacgttcacgcaatccactattaaaacgatcaacgagacgggaatatatgccaccgcatgcacgccggtcagcagcttgacgctaattgaacattttgcaacattaaaaaataacgtgcccgatcacacgctcgttctcgatgtggtcgaccaacagattcagttttcaatactcgacattatcaattatttgatttacaatggctacgtggatttgttggccgaataacgcgtatatagacgcttgtacgttcatcgtagtaatcattttaatacatttgattgaactaaacatacatctgcaatgggtgaaagagtcactaaattttgcaatggaaaacggcgataaagaagacagcgacaatgaatagagtttatatttttatttaataaaatattgttcgtaatccataatgttttgtattatttcattgtgataatgttcccaatcttgcacgggggtggggcatcgtttgactttgacgtagaaatcgtacgcgtagttattagttggcagatcgtcgacaagtgtgatcgacttgaaaaagtttacatttttatcgctcaaatatttaattacaatttttggcgatttgggtatattgttgtcggatcgatgattgtgaatgtcaaaaacaaatttattttcaatgaaacgcttttttaaattgtaatctacaatagcgttgtgtgaattttgaactaaatcagagcgttcttcttgaacggtggaaccttcgctgataatgatatcaaaatagccttccaaatcgacgtctcgcatcgagtgtgctacatgatctctactgccatacgaccacaagactaaaacgcaacccatctcgtgcaactcctgcaagctgtcatacacaaacggatctcgaat 209|ctcaacttgctcctcttcggttatgagagtgctgtccaaatcaaacacgaccacgtgcggaaatccccacgtcaaagattcgcttttgagagagaccactttgtagtgtggcaatagaaaccattctttaagaaacgaatacattggcggtttgttgctaagcacgcacatgtggcccaacactggcgttttgaatgcgcgtttaatattgtgcctgatgtcgcgcatgtcgtcggcgggcgctttgaatatttgcatacagtaattgtaattgttttctatgatcttgcacagctgcgggtcgttgcaaaattgaaatattacatattcaaaaaatttatacttttcaaagccaaggtatttgaggtcggcgtactcgcttaaaacgagaacatgtcgtttgatgatggcgtcgttaaggcgcaaacagatccatttgctttgaagcgaggaggccataatgtacaaaaatggaccagttacgccttatttaaactgtttaaagagtttcgtataaacaaaaactactctaaactaatagatttcttaacagaaaattttcccaacaacgtcaaaaacaaaacgttcaacttttcgtctaccggccatctgtttcactcgttgcacgcgtacgtgcccagcgtcagtgatttggtgaaagagcgcaaacaaattcgattgcagacagaatatttggcaaagctgttcaacaacacaataaacgatttcaaactgtacactgagctgtacgagtttatcgaacggaccgaaggcgtcgattgctgttgtccgtgccagctattgcacaagagtctactcaacaccaaaaattacgtggaaaacttaaattgcaaactgtttgacataaagccgcccaaatttaaaaaggaaccttttgacaacattctttacaagtattccctaaattacaaaagtttgttgttgaaaaaaaaggaaaaacataccagcactgggtgtacacgcaaaaagaaaatcaaacacaggcaaatattgaatgataaagttatttatttacaaaacagtaataaaaataaactatttgagcttagcgggcttagtttaaaatcttgcagacatgattttgtaacagtcgaaagccaaacgagggcaggcgacgaaatcgcttcgttcattcgctactgtcggctgtgtggaatgtctggttgttaatagtagcgtgttctgtaacttcggcgacctgtcgatgaacggctcctggatcttctgtatgtgcggggtctacccgggcggcgtctgtaacccgagcttctgcgcctgcgtgtcgaaccatatgtggtaccggttgaagaacggcgacggcgacgataaaccatgtttaaattgtgtaatttatgtagctgtaatttttaccttattaa 209|tattttttacgctttgcattcgacgactgaactcccaaatatatgtttaactcgtcttggtcgtttgaatttttgttgctgtgtttcctaatattttccatcaccttaaatatgttattgtaatcctcaatgttgaacttgcaattggacacggcatagttttccatagtcgtgtaaaacatggtattggctgcattgtaatacatccgactgagcgggtacggatctatgtgtttgagcagcctgttcaaaaactctgcatcgtcgcaaaacggaatttcggtaccgctgttgatgtattgttgcggctgcaacatttgtatcttttcgccgcgctcgatcaacaattcttcaagagtggtgcgtttgtcgcgctgtaaagccacgttttgtaacagcactattttcgcatatctcataatcggactgttgaaacagcgtgcaaacgacgaccgcataatatcgacggtcgtcaagtcgattgtggtcgaaggcatctccaacagagatcgcacggcgtccaacagcgtgtccgtttgaacctgcgtcatttgcggtctgcacgtgtagtcgtcaaacgtggtttcgagcagtttgaacaacgaatgatacttttccgatcgcagcaaaaatatcatggtcatgaccacgtcgctgattttgtattctgtagaactggtgctgttcaacgaatagtgatggattagtttgcgagcagcatttctgtatcggcgcatgttgatcaactcttcggaaggctgcgcgggcgcggcggcgttggctcgcgcaaacaaatttattacgggacgcggcgtaggctgcgcggacgctggcgcggcgacgacgtccgcgtttcccgccgcgtactgagacgctatggcagcgttgttatttaaaattgtgttttgcgatttgcgagccacgtgcatcataaaatttatcaacacgtcggtgttcaactgcacgctttgatgttcgtcgcagagcaaaggaaatagctggggccatatcgccaattgcataggctcgtctatttttaaccgcaatttgtttatttccaaatacaacgcgatagcgctcatcgtgaccgacgacgcacacttactctgtaactatcacttggatcgtgttgtcgtaaacgcttcccaaaaagtctaacacgttgaccgtttcgattctattcaacttaattgtggacgcgttggcttgcatcggttccaacagactgcgcgctccgacagattgagtagacaaaatttttaaactttccgtcttattgggcgtaatgtcgttgattaacaacgacgcagccgtttgagaggccgcagtgttgatggtttgcaacatgtcgacggccgccatttgcgtttgcgccgaaggtcttgctggcggcctgttgc 209|ggcggtttcttcgtgcttgcgacatgttgtcgtcagtgtccatatcggtatcatttattgaagcaatcatggttgagttcgataagcagagatatttcgttgtccaattggtacttggtaatgatgtgccttataaatgtttcgggcacaatcatttctgtcattagcacgttacaaatatctattttgatcaatttcaatttatgaattaacagattaatgttttcgtccgagtacttgctcatgatgaaacgacaaacgttgcggagttccaactccgctaccggatacgctttgttgggcaaactctctaaatagtgtctcaaataaaagccgatcaatacggtggacgctattttgttaacctttttcattttagtattgcggcccatttctatcatgaagtttttaaacggtagcaacagcctgtctccgttagcaacagtggagcagccgttgcattgcgcgctcaaaatactcaacacgcgctcgtgatcttcttggcgcaatccgacggttgcttttttgcattctttgacaaatggcacgcacatgtcgcgtttcgtgtacaaagaatacgctttgtcgcaaatcaagttatagaaaaattgcacaaatatctgcgtaatcaagttgttttcgttaataatgtcactttcgtttttgtaatcggttcgaagcaacacgtacaacatcagaggcatgccgaacatgggtcttaaaaaaatgtcccaaccattttgcaagcccgcgtcgagggtgctcagcgaggacgccaagtatttgcatttgcactcaaaacattgaattttgtttgcgggcttgcacgactgacacatgatcgcatccacgtcgggtgccggcgtcggattgtaatatttttgcaagtattgcataatggtcctaaaatggggtacctgtttgataaactcgtcgcgcaaaaatatcgaaaaaatgttttttacattgtgtatgttgtctgtgttgttggcttgattctcaaaactactctttatggaaacaatacatttgttaaattctgtgaaaaaagtaagacctttactgtccacgatcaagctttggttgaaatattttgaaaataaaaaacacaacgaatcgatttcatcttgtaacaattgcgcttcaaaacacacgttttcaaagcggtcgtaaatgttaaaccttaaactgtattgtaatctgtaagcgcacatggtgcattcgatataaccttataatatgaacgattccaattctctgttgattacgcgtttggcagcgcaaatactgtccagaaacatgcaaacggtggatgtgattgttgacgacaaaacgctcagtttggaagaaaaaatagacacgttgaccagcatggtgttggctgtaaatagcccgccgca 209|atcgccgccgcgggtaacatccagcgacctggccgcatcgatcattaaaaataacagcaaaatggtgggcaacgattttgaaatgcgatacaacgtgttgcgtatggccgtcgtttttgttaagcattatcccaagtattacaacgagacgaccgccggtttagttgccgaaatagaaagtaatctgttgcaatatcaaaattatgtaaaccaaggcaattatcagaacattgagggttacgatagtttattaaataaggcggaagagtgttatgttaaaattgatagactatttaaagagagcattaaaaaaatcatggacgacacggaagcgttcgaaagagaacaggaagcggagagattgagggccgaacaaactgccgcaaacgctcttctggagaggcgagcgcagacgtccgcagacgatgtcgttaatcgtgccgacgccaatattcccacggcatttagcgatccgcttccaggccccagcgcgccgcggtacatgtacgaaagttcagagtcggacacgtacatggaaaccgcccgacgtaccgccgaacattacaccgatcaggacaaagactacaacgcggcgtacactgccgacgagtacaattccctggtcaagacggttcttttgcgtttaatcgaaaaggcgctggccactctaaaaaatcggttgcacataacaactattgatcaattgaaaaagtttagagattatctgaatagcgatgctgatgctggagaatttcaaatatttttaaaccaggaagattgtgtgatactgaaaaatttgtcaaatttagcgtcaaagtttttcaacgttcgttgcgtggccgacacgttagaggtaatgttggaagcgcttcgcaataatattgagttggtgcagcctgaaagcgatgccgtacggcgaatagtcataaaaatgacgcaagaaattaaagattcgagcacgccgctgtacaacattgccatgtacaaaagcgattatgacgccataaaaaacaaaaacattaaaaccttgttcgacttgtacaacgacaggctgccaatcaatttcttggacacgtccgcaaccagtccagttcgcaaaacttccggcaagagatctgcggaagacgacttgttgccgactcgcagcagcaaacgtgccaatagacccgaaattaatgtaatatcgtcagaagacgagcaggaagatgatgacgttgaagatgtcgactacgaaaaagaaagtaaacgcagaaaattagaagacgaagattttctcaaattaaaagcattagaatttagcaaggacattgtcaacgaaaagcttcaaaaaattattgtggtcaccgacggtatgaaacggctgtacgaatactgcaactgcaaaaattctttagagactt 209|taccgagcgccgctaactatggcagcttgctcaaaaggctaaacctgtacaatctcgatcatatcgaaatgaatgtaaatttttacgagttgctgtttccattgacactgtacaatgacaatgataacagtgacaaaacgctttctcatcaattggtaaattacatatttttggccagtaactattttcaaaactgcgctaaaaacttcaactatatgcgcgaaacttttaacgtgtttggcccgtttaaacaaatcgactttatggtcatgtttgttataaaatttaactttttatgcgacatgcgtaattttgccaaattaatcgacgagctggtgcccaacaaacagcccaacatgagaattcacagcgtgttggtcatgcgggataaaattgttaaactagcttttagtaatttacaatttcaaaccttttcaaagaaagacaagtcgcgcaacacaaaacatttgcaaagactaataatgttgatgaacgcaaactacaatgttatataataaaaaattataaaatatttttaatttttatttatattcagtacatttacacatattaacatattgtttatacaaattcttataatcattatgatttaaattgaattgttgtctaaacaaattaaacactttattaaacaataacttttcgttgtaattttttactttgcacatgttataacaaaaaattaaaattttcatcatgtctgatttgtctatggcgtcacagttgcttttaatgtaatcgcaagttaaccactcaaaaggacccttttctatttttaatttgtttaaatctttataatcagacttcagtttgtaaattagatttccacatcgaataataaatccttccagcgggctttggggaaacattaaagacttgaaatttaacctttctacaaaatcgttgtacaaatatttgtgacacggaatagtattaaaccccacgttagtcaacaactcttgcgcctccacaaagggcacaaactccccgccgtataattgaatttcgtaagcgtagtatttcaaactctctttctggtccacgtagttaattacgttaatgggtgtcgtttttgcgtcgtctttccaacccattaattcgccgtagacaataaaaccgtcattgaaccgcgcctgaagcgatcgcatgcacgtttctaaatcttttcgaatgcggtaataattcataaaattgccgtccggtctgtaagtgtttcttgacccgtacgtaattttattttggttgcaaatgattctgaaattacaaccgtccaacttttcttgaacaataatttctttgtcggccaacgtaccttttttaccttgatctagatgcgacacagatggataaatttgatacacaattttattctcatcttc 209|gggcattacgggtccgcgttcatttaacgcgtacatgacaatgttgtggcgaatgtcggtgcgctccggcggttctggcacgtggtgcagtctgtcctgcaattgttgcttccattgttgaaaatattcggtccattcttgttgatactcgccgcgttgcatgagttttacgtacagttttaaaagtttgacattctttacaaataacgttagagtttcgtcgattttgtatcctccattatttttgtttaaatccaatacatttaaatcgttcactaccagttgattgtttttatccatcgtaatttttatctcatcgcccacgttgaacaacatgtttaaaattttggtggatttcggcgcacgtttataatctaaataatattcaacgtacacgtaattgaacatgagctgcaacaatcctttggcattgttcaaaattttgtatctcatcaaagtataaataattttcaccatcgacaccgtcatcaacttggttacaaactcgtacaattgcaagttttcaataccgtatttgtctttaaaatcttcacgtttactgaacatgcttaattcgggagattttccagtcaaaatgccaattaatcccgtgtacaagtcaacgtatttgacatcgttgcccgattcatcttttgcatgtcgatttttcaaaagctctttattgtcgataaatttttcaaaggtctctcgatcacatttagtgtaaatatggtagtcagtgtcgctgctttcgaccgcgtatcccttggcatggctgcccgtatcaatgcaaatgtacaccatgttagaatgtgctgcttactgtgcctgtatcaagccttatatacctcaaaatatttcacatttttgcatcatcgtaaaatatacatgcatataattgtgtacaaaatatgactcattaatcgatcgtgcgttacaagtagaattctactggtaaagcaagttcggttgtgagccgtgtgcaaaacatgacatcataactaatcatgtttataatcatgtgcaaaatatgacatcatccgacgattgtgttttacaagtagaattctactcgtaaagcgagtttaaaaattttgtgacgtcaatgaaacaacgtgtaatattttttacaatatttaagtgaaacattatgacttccaataattttgtggatgtggatacgtttgcaagacaattgattacagataaatgtagtgctctaatcaaagtgcggatctgttgccggcaaacattttagagattgtagagaaggccagagacaagtattttgagggccaactcaaaaaaactatgaatacattaaaaaattatttttacgaaaaaatatatggacgattcgatagattataaagattttaacagacgcatcctattgatag 209|tttttaaattcgctttaaacaagagcacaatactttccatcgtacaaagagatcatcgagtggccattaaacgtttaaacaaaattaaccccgatttaaagagttctccgcgcaatgcttcagcattacaatgaatgtttggaaaatctagacaatccagtcacggacgaacatcatttgttgacaaaagagttgctacaaaaatatttatcgaagcgtttgaatacagttacaccaacactaatgccatcagcatggacaaaacagatgaatttgattttattaaaccggcattgaaacctttgccagatgcaagaccgccatcgcttttggccaacgtgatgaacgaacgtaaaagaaaattacaaaacaccaactcaacggcaaaatgtttgctaccagcaccaccgccacaattgcgtaaacttgaaaaaaagaatcatttattgcctttgttttctttgtaattatattgttgcatttctatttctaatatcatagttttctaataaagtagtttcatatttttgtttttgtacagtaattgtttcttggtttaacaagatcacaaccaataacataaagaataacacaatcataacaaaaattaaaaagccgcatactactagaacaaattctttaattagcgatcggtttctatttacaaattggccgagctgatcgccttcagtcggcgagttgtgggcttggatgatgtcgacgatattgttgccggcgcgaccgcctgtcgctctcgatataatgtcggccgccgtcggtttcatgatgtgcttaactacaaataatagttgtacttgacgggcgtcaccgtgatgccgctgctaaaacctccgtccgttaagacgcgttgcgttacaaaattaatgtttgtccgattagcgtagtcggaataatcaaacgtgttgggcggactaaaatcgggcatgttgatgggcacaatgccgctggagctgatagcaatgctgtcgttcttgcaaaacagccgaatttttttgtagggctctgctttattcggcgcagacgacaccatctggtcaaagttgttcaattttatgattacgttgggtaccaattgataggggaaaattattttctggaacattttgacaaagtccacaaccgtttggctatagtcgggaatgccgagcaaagactgcgcctgtttaatgtatttgagactggagcggtttactgtagcgcaattggatggcacgtcgcccttcataagccggcgcgttctctcccaattcaatttgttgtacaaattatcaatctcctcgtgcggcagattgattacatagcgcgcgggctgtttgcgatattgaaagatgcaaaaaatgcgtttcaacgacaatatcttcaccatggtggacgtttcc 209|agattgaaacataacaaaaagtcattgctttccaccaattctttaaaatgagacagcggaatttcacaagcgatcggtcgcaaattgctttttattggaggcggaacgctttgaccgttgcggttttttagtaacgcgctgcacgcagattgcatgtccgtttcgggatacgtaaactcgatgggacatttggggttttcatggtgaacgatcatagtgttgcaataaaacaagttgttggtcaggagcacgctaaaaacacgcgtttcgcccgcaccgatttcggtgatgggtaccaacgggttccagtagactatggtggcggacgctgttttttttggcgatcgactgtctatgttaacatcatgctcgtgcctgtacactagcacagaattgaattttggaaattgttttttgtcaatgtacaaccggtcgtcgtctgtgggcacgtacacgatcaagttttcgattaatttgttgcctacgtcgctttgcggttccaccaaattgtgagggaacgcaaaaaagcgatcgctaatacaaacttgaatctgaaacgggcactccatcgtgatgtatatgtcttacttcattagactttagattattttaatttgtgaactcgtaccgtattcaatagggtgtcgggcacgtaattgtaatggtaaaacagatcctgttgaacacgtgcgttgttcactacgattgaaatgcaaaaatacatcaagtacataaacactatgattagaaaggtagcagacagaaaatatttcatctttaaatcttatgctagttgaataaaatacatagtacttttatacgtttatttatatttgttttctttgttataaccgtaattgtaaaacttgtgatcgtgctcgccaggcataatttctttgcacatcagcttgcgaatatatgtgacatcttcgtacaccgatttcttgatgttaccatcgtgaagcgttgtcggcttgagaggtttgcggtcgttgttgtaaaaattttgcaccgaataattatccatagtgcagcacaggcaatgtcactgatgcatatgctttaattttttattgcattcagttattatatgatttaataaacgtacacaatagcacgtttatcggttaaagataactttcaatatataaaagtgtttgaattgcgagaccgtcaacataacgtttatcaacgcgatgactaaacgacaatttgctttgctgtttgtgtggcaccacgacaaccaatttgtttgcaacacggacgaatacccgttttggcacaacattgaataccatgcacggcgctataaatgcatcgttttgtactgtgtggaaaacgacggatcgctacaactgcccgtttgcaaaaacataaatctcataaattataaaaaagcg 209|tatcctcattattatggaaactgtgttgacagtatagtgaaacgtgctggcaaaaattgattatatgaaagtaactgcaatgttaaacccccacctgttggacgtcgcgtacaattatttgctgttgatggacatggattgtgtggtgcaaagcgtgcaatggaaacaattgtcaaccgacacgtattgttttgagccgttttacgactctcaaattaaatggttgtacgcgcccaaaagcggacaaagttttgatagttatcttgaaaactatgcaactctaattcgagtcaaacaagtgcagcaacatcgaaaagaattaatactgcattgtgtggattttcttacaatgaaagcaaatgacaattttatggtgttcaaaaattatattaacatgattataaaagtgtatttgcaattttacaattacagatttcccatcaattttgaggacaacacgatgaaaccttgtgtaaatttaacttttagacgtggcggcagttggaaaactcaactgcaacccgtatgcaattatgtttacaaaagtaaaaatatgccaaaatttattaaataaaacaaattaatttaaacaagcgtttttattgacaatactcacatttgatattatttataatcaagaaatgatgtcatttgttttcaaaattgaactggctttacgagtagaattttacttgtaaaacacaatcaagaaatgatgtcatttttgtacgtgattataaacatgtttaaacatggtacattgaacttaatttttgcaagttgataaacatgattaatgtacgactcatttgtttgtgcaagttgataaacgtgattaatatatgactcatatgtttgtgcaaaaatgatgtcatcgtacaaactcgctttacgagtagaattctacttgtaacgcatgatcaagggatgatgtcatttgtttttttaaaattcaactcgctttacgagtagaattctacttgtaaaacacaatcgagggatgatgtcatttgtagaatgatgtcatttgtttttcaaaaccgaactcgctttacgagtagaattctacttgtaacgcaagatcggtggatgatgtcattttaaaaatgatgtcatcgtacaaactcgctttacgagtagaattctacgtgtaaaacacgattacagcacttcgtagttgtatcgaaaattgttcaatggctctttgttaatgtcgtaattgattaatatgtcgtacaatttggcggcgttgtgtttgcacacgaccgtttttagttcttgaaacattttttcgtgtatgtttagcatgttgtatttcagagtgcgatgtgtaatgctggtgacgagcatcaaaatgataaaatctaaagcggctaatttgtaatcccgttcatacgctc 209|tgtaatcgccaacaactctgtggccagatctttttagattttgacaggcgttatggtacgaattgataatatttactatagtttctcttgttatcggtttgtcgattaaactgttaacaaacatcacgttgcccaagcgcgacggtttagacaccgacttgttttttgtctgttcaaatttgtacaaattaaaaacgctcatagactggtcgtcaggcagtgtgtcgttatacaaacaaaatggtaaaacgtttaattcgacaaacgacgagcacattaaagtttgttggctgttaacgtcctggggatgtaaactgttattcataacgtaacacacttcaatgtcggaatgcttgttttcaaatttgtccttgtctacagtttcaatggtgattgagcgaggtttgagtttattttctaaattcatttggatattttcaatatggtataccaccgacacgttgtgagccagcgatccttgattggttttaatcatattcaaaatattcatgatatggttgaaaaaagagtctgtcaaaacgtttgtgtcgttgttaaatatcgctttccagggtttactgttgcgtgactcaacgacggccgtgtaacataacaagcgcgccagttgcatgtgcgacaacttaatgttatcaatgtcggtgatgtttggcaccagattttcattgccgtcttccagtagcgtgctcagttcggtcgagtagttattcaacgatcgattgtgcgattcaaacaagtttactatcgcaggttgtacatagttttttatgtcgtcaaattgaattatatcgatcttgtccttgttctccagcataaacgacaaattttttaggtcgaatttaatatttggcgcgttttcgttggactttttgtaatttaacaacatcgccaacagtttgtgtaactcgccgttagcttgatctttgctaaacagtttattggtagcgtaattcacgttgtcgttcaaaaacagcaactcgttgatgatcattttttgtaaaagcgcgtacttgctcatgttgacagaatctcttacatttcagttgtaaacgcgtctgtacaaattggccatgcgattcggaatgcacacggggatcgtgcgagccagtgccgtttggcgaaatagcattttttcatagccgctcgaacaatcgcacgcgtccggcgaaaattgcaccgtgttcaaattcatattcaaccggccgtcgttgcatagataaggcctcggtgttcccgtatcgtccaccaagtctctgtacgtgctcacgcatgtttgagacacgacaaaatctccgccggcggagaaaacgtgaaccaagcccagtgcgggatcgcattctatcaagtccggagcctgcgcgtttaccaaagcgtcggaggcg 209|ttgcaaaagccatcctggcaggtcaactcgtttgcagcgctggagatcacgcagttgtctctacactgctgatccgtcacgcacggtaaccggttcaatgaacaatctacgcctcgattgcgctgaaacgtaaaatttaacggcggcgcttccaactcgttaatgtgcatgtatgcatcttgcaaaataaatttttgaacaaatttaaacgtgtacatgtacacgattagtataattaccagtagaataagtatttgccaaaagttcaacatgatcgtcttaactgagtgtgaaaagcgtggtgtgacgcacgaaatgactggttgcgcaaaaaataaaccggggtctatataactcggcgtcgaccgcgttcatttttaccgtcatgcatctgacggctaatgtattgctcgttcctaacgcgctcaaaaagcgggacgtgaaatacatttataatacctatttgaaaaattacagtgtaattgaaggtgtgatgtgttgcaatggcgattgtttggccgtggtggtgttggaccgaaatcagctgcaaaacacggacatggaagtgttggagagtttagaatacactagtgacaacattgaactgttatgcgaaaaaatatgtgtgatagttgataattacgacaagtattaccaaaaaaattgtgtataaataaaataccaaattttattatatcattttgttttatttaataattaaagaatacaacgccacatctattcctagtacaacaaataatttgattattatttttgagtgcacattaaaaaataacaaacagtgtaaaaatactacagaataatacaatacataaatattatagtaaatagctgcaattttgatagcgtaatttatactttgatatttttcaacgtacaacgttaaatgttgatacgcattattcacaaataacaaaatttttctaatatgccatttgtccgcaattgtttttgcgatatcaaagcctttttcaaacaattgaaaaattgcaaacaaaaccacgtacatgacgttatacatagtgttaaagtttttacataacaattctataatgaagaaaattgctaaacacggcatgagcgcgcacataatcgcgttggccgcaaatatctcgtacgtacaaaaatactcggacattctccaataagtaaaatgcattttgctattatactgttgtttcttctagtgattattgcaatagtgtacacgtatgtagacttgatagatgtgcaccatgaagaggtgcgttatcctattacggtttttgacaacacacgcgcgccgcttattgaaccgccgtccgaaatagtaatcgaaggcaatgcacacgaatgtcacaaaactttgacgccgtgcttcacacacggcgattgcgatc 209|tgtgccgcgaaggattagccaactgccagttgtttgacgaagatacaatagtcaagatgcgtggagatgacggccaagaacacgagacgcttattcgagcgggagaagcgtactgcttggctttggatcgagaacgcgcccgatcgtgtaaccccaacacgggtgtgtggttgttggccgaaactgaaactggtttcgctcttttgtgcaactgcttacggcccggacttgttacgcagctcaacatgtacgaagactgcaacgtgcccgtgggctgcgcgcctcacggccgtatcgacaatatcaacagcgcttcgatccggtgcgtgtgcgacgacgggtacgtgagcgactataacgccgacaccgaaactccgtattgccgtccgcgcaccgtgcgcgacgtaatgtacgacgagagtttttttccgcgggcgccatgcgcagacggccaagttcgtctggatcatccggcgctcaatgatttttaccgcagacactttagactcgaagacatttgcgtgatcgacccttgctcggtggacccgattagcgggcaacgcacatcgggacgcttatttcaccaaccaaccgtaaatggtgtgggaatcaacggatgcaattgtccggccgatgacgggttactgcccgtgtttaatcgacacaccgccgacacgggcatggttagacaaagcgaccgcaccgtcgcgaacgcttgcttgcagccgtttaacgtgcacatgttatcgttgcgtcatgtggattacaaatttttctggggccgcagcgaccacaccgagtttgccgacgcggacatggtgtttcaagcgaatgtcaaccaactcagtcacgaacggtatcgagcgattttgtactcgttgctcgagtcgcacccggacgtaacagaaatcgtaacagtcaacatgggtgtcatgaaaatttccgtgtcatacgataccacattgaaaaatatactattaccatcttctgtttttaggctatttagatttaaagaaagtggcactgctcagccggtatgcttctttccaggcgtaggacggtgcataaccgtcaattccgattcgtgcatcaggcgacacgctggtggtcaagtgtggaccgcagaaacgttcaccaactcgtggtgtgtactgagtcgtgaaggtacgcatataaaagtttggagtcgcgcgtcacgatatccacgcggagacgcgcctgcagcgttaagattgcgcggcttctttctgaacaacgatcgcgaacgaaacacaataagagcggtcactacaggcgacatgacccaagggcaacaaatagacgcattaacccaaatacttgaaacttaccccaactactctgtataacaacatgagcattttaaaagttgtagaagcgtg 209|caatttggcacacacttttttaaaattgggttatttatttagggccaagacttgtttggatatcgctttagataatttggaactattgcgtcgaaagactaacataaaagaagtggcagtcatgttaaacaagaaaactacagagtgtttgcaattgaaacgaaaaatagataaaaaaattgcacaacgtgttttaataaaaatttacactatcaaatgatgacatcataacgggttcaatattctgtgtgcaaaaataaatgacatcatatttcaaacttgttttacgcgtaaaattctactggtaaaacaagtttgagatatgatgtcatcatcacaaataatagtatgtaataaaataaacatatttgtgtgtaaatataatttattacaaataaattttacattgaatcaatctgtcttcgtgtttgttgtaaggtcttcgaatcttgtgtttcagcccctcgggatggtcaaaatgcgccgtagtaattgttaatggatctttcaacgattttttgcccatggcgagtgtgacaaacgcggccacgacaaacagcaggataatcagtttcatggtgttctatattcgacaatatatgggtcgcttctaaatcaccttgtccccaaaagcctcttttatagttttttagaacacgttgtgtattccaacagtaattgttccatctctttcaacagccattcagcatccggtcgttgactgtaatcatgctgaattaatttacaaacaatttcggtcaatttaggatggccttgggataaacttgccggcatttgctgtacattgtttctaaagttagttagcgtagtttcgcgttccaaagcagtcttgaagggcattatcaattcgaataaaacaatgcccaaactatacatgtcatttttgggggtgtacacttttttgatttgttctggtgcagcgtacaaagttatattttgagggttgtttttgataaacgttttgtatagactgccaaacatgccgcccacatacaaatcaaagtcgggcccagtcatgaaaatatcttcgggattaatattgtggtgcacgatatttacggaatgaatcgctttcacggcgctcaccaaatcaacaaacttgctaatataaaagccaaaatccgccggaactttaatgttggtctttgcaaaagtttgcaaattgcgttgtttcaaatagtcgctcaacatgtactcgtttagaggcgacgcaatatatatgcggtgctgccgcggattcaaataaaccaattgttcgggtttcatggtatacagttaagtgttaacgcgtcactaaattcagacacgagcgcacgccctatatacatacaatttatcgcacaagatgcttaacgcgatctgtttataaactaaaacgc 209|actgcaataaattttagcaagcatttgtatttaatcaatcgaaccgtgcactgatataagaattaaaaatgggtttgtttgcgtgttgcacaaaatacacaaggctgtcgaccgacacaaaaatgaagtttccctatgttgcgttgtcgtacatcaacgtgacgctgtgcacctacaccgccatgttggtgggatacatggtaacattcaatgactccagcgaattgaaatatttacaatactggttgctgttgtcgtttttgatgtccgtggtgctaaacgctccgactctgtggacgatgctcaaaaccacagaagcccatgaagtaatttacgaaatgaagctgttccacgccatgtactttagtaacgtgctgttgaattatgtggtgtttttggacaatcaaatgggtacaaattttgtttttgttaacaatttaattcactgttgtgtactttttatgatatttgttgaattgcttatcctgttgggccacacaatgggcacgtacacggattatcaatatgtcaaatcgtgttatatggttatattgtttgtttcagttatgagtgttactattgttatgggtttagagtgtttgaaaacgaaactaattgataacagtttgatgtttaacgcgtttgtgtgcgctttgtacattgtgattgcaataatgtggtctttaaaaaataatttgactagttattacgtttcaaatttacaaagtattcaagttgttccgttttcatacaacgatccgccgccaccgttctctaacattgtaatggatgacataaaaaataaaaaataatttataaaaatgttttttattctttcacaattctgtaaattctaaacaaaaaatataaatacaaacttattatgttgtcgtctaaataaacatcaatttgtaaatctggacacctattcatatcattgatattacagtctactatacaacaattaaaactaaccaaattatctttacaacaattaaagcaattaaaacaatttaaataatcttcattgtcgtcgtataagtttatttgcactgtagacggtgttacacagcgatccattcgacgttcgtgttcgatcaactttctcgccaacttgtaccataaaaattgtttggacaaaaagttttccaacaatggtaacggccaattcaacgtgacgatgcgcacgtcctcgggtatgcatttgttaaaaaacacacagctcgctttaccaaacgaaagcaaaggtactaaatatggcgccattggctgatttgttattccaagataattacaaataaactgatccgtcgtggggtgataactggcaggtgtcagctttaaataatcttcaacgttgttgtcgcgcaaaagtctgcattttacacgcgttgttaatc 209|ccacgacttttgcatgtaaaatcggatccaaatactgcagaatcgtgtctataatttctaatggtaaacgtatgcgttttgctcgtgggcgctttgtaacgctcgacatcctaataacaactaacacaaaactaaaatgatactcaatatattgcttttacagttcatctttaggtttaaactgtgcgtttatcgcgttgagcaagtcgccgttatcggcatcaatctcccaagcaaacaggccgcccaatttatttcggtcgacatatttaacttttcctaacacagagtcgacgctgtcaaacgaaatcaaatcacctttacttttatcgaaaacgtacgacgcttgagcggcgctgtcaaacgtgtacacataattgttgagatctttttgaatttgacgataatctacaacaccgtcctcccacgtgcccgaccccggcccgttgccagtgccggaaaaatagttgtcattcgtataatttgttacgccggtccagccgcggccgtacatggcgacgcccacaattattttgttgggatcgacgccttgtttcagtaacgcatcgacagcgtagtgtgtagtgtatagctcttccgagttccaacttggcgcgtagactgttgtttggtagcccaaatccgtgtttgaccaagcccctttaaaatcgtaactcatgagaaatattttgcctaatgacttttgcgcttcggcgtagtttaccacggcaatcttgtcgtaacccgcgcttatagcgcttgttaattcgtaaaccctgccggtttgcgcttcgaggtcgtctagcattgcgcgcagctcctccaacaacaaaatgtatgttttggcgtcaccgtccgcatcgcccaacgacgggttagcccctttgccgcccggaaactcccaatcgatgtctacaccgtcaaagaatttccacacttgcagaaattccttaaccgaatctacaaaaacgtttcttttttcaacatcgtgcataaaataaaatgggtctgatagagtccagcctcctattgaaggaagaatttttaaatgggggtttgctaattttgccgccatcaactgtccaaaattgcctttatacggctcgttccaagcggacacacctttttggggtttttgtacggcggcccacggatcgtgaatggcaactttgaaatcttcgcgtcccttgcacgatctttgcaaagattcaaagcttccgggtatcgttttgagggcgtcgtttattccatcgccgccgcagatgggtatgaaaccatacaacaagtgtgataaatttggcaagggaactttgtctacgggaaagttgcgcccgtacacaccccactcaacaaagtacgcagcgacaattttatcctctctcctgccaggtttgttgttt 209|tccagccatgtgtattcgagcggtgccagatggccgccgtcggtgtctgcgactttgaccaacacgggatcgctcacggaacagccgtcctcattgcaaagtttgacacgcatgttaaattgcccgctcacaagaactttaatggtagcccttttactttcggcgtcgcctttccatacctgctgctcgtcaaacaacacgtacgctatgtcgccaatgtcgccgttccagacgttccaactgacttgaacgtcgacttgttctttaggctttattaaattttcgtaagcggtggcctcgtaatttatttctacgagcgcataattgcgatcggcccaatcgatcaccggcgtgccgggaatcgcgttagaaacggcgaccaaccacaaaacgtttaacaatttgtacaacattttaatttatcttaattttaagttgtaattattttatgtaaaaaaatgaacaaaattttgttttatttgtttgtgtacggcgttgtaaacagcgcggcgtacgaccttttgaaagcgcctaattattttgaagaatttgttcatcgattcaacaaagattatggtagcgaagttgaaaaattgcgaagattcaaaattttccaacacaatttaaatgaaattattaataaaaaccaaaacgattcggccaaatatgaaataaacaaattctcggatttgtccaaagacgaaactatcgcaaaatacacaggtttgtctttgcctattcagactcaaaatttttgcaaagtaatagtcctagaccagccaccgggcaaagggccccttgaattcgactggcgtcgtctcaacaaagtcactagcgtaaaaaatcagggcatgtgtggcgcctgctgggcgtttgccactctggctagtttggaaagtcaatttgcaatcaaacataaccagttgattaatctgtcggagcagcaaatgatcgattgtgattttgtcgacgctggctgtaacggcggcttgttgcacacagcgttcgaagccatcattaaaatgggcggcgtacagctggaaagcgactatccatacgaagcagacaataacaattgccgtatgaactccaataagtttctagttcaagtaaaagattgttatagatacattaccgtgtacgaggaaaaacttaaagatttgttacgccttgtcggccctattcctatggccatagacgctgccgacattgttaactataaacagggtattataaaatattgtttcaacagcggtctaaaccatgcggttcttttagtgggttatggtgttgaaaacaacattccatattggacctttaaaaacacttggggcacggattggggagaggacggatttttcagggtacaacaaaacataaacgcctgtggtatgagaaac 209|gaacttgcgtctactgcagtcatttattaatctcaacacactcgctatttggaacataatcatatcgtctcagtagctcaaggtagagcgtagcgctctggatcgtatagatcttgctaaggttgtgagttcaagtctcgcctgagatattaaaaaactttgtaattttaaaaattttattttataatatacaattaaaaactatacaattttttattattacattaataatgatacaatttttattattacatttaatattgtctattacggtttctaatcatacagtacaaaaataaaatcacaattaatataattacaaagttaactacatgaccaaacatgaacgaagtcaatttagcggccaattcgccttcagccatggaagtgatgtcgctcagactggtgccgacgccgccaaacttggtgttctccatggtggttatgaggttgcttttttgttgggcaataaacgaccagccgctggcatctttccaactgtcgtgataggtcgtgttgccgatggtcgggatccaaaactcgacgtcgtcgtcaattgctagttccttgtagttgctaaaatctatgcattgcgacgagtccgtgttggccacccaacgcccttctttgtagatgctgttgttgtagcaattactggtgtgtgccggcggattggtgcacggcatcagcaaaaacgtgtcgtccgacaaaaatgttgaagaaacagagttgttcatgagattgccaatcaaacgctcgtccaccttggccacggagactatcaggtcgtgcagcatattgtttagcttgttgatgtgcgcatgcatcagctcaatgttcattttcagcaaatcgttttcgtacatcagctcctcttgaatatgcatcaggtcgcctttggtggcagtgtctccctctgtgtacttggctctaacgttgtggcgccaagtgggcggccgcttcttgactcggtgctcgactttgcgtttaatgcatctgttaaacttgcagttccacgtgtttttagaaagatcatatatatcattgtcaatcaaacagtgttcgcgtgtcaccgactcggggttatttttgtcatctttaatgagcagacacgcagcttttatttggcgcgtggtgaacgtagacttttgtttgagaatcatactcacgccgtctcgatgaagcacagtgtccacggtcacgttgatggggttgccctcagcgtccaaaatgtatacctggcactcgtccgtgtcgtcctggcactcgagcctgctgtacattttcgaagtggaaatgccgcatcgccacgatttgttgcacgtgtggtgcgcaaagtgattgttattctgccgcttcaccaactctttgcctttgacccactggccgcggccctcgtt 209|gtcgcgaaaacagtcgtcgctgtcactgccccaacggtcgatcagctcttcgcccacctcgcactgctgcctgatgctccacataagcaaatcctctttgcccacattcagcgttttcatggtttcttcgacgcgtgtgttgggatccagcgagccgccgttgtacgcatacgcctggtagtaccccttgtagccgataatcacgttttcgttgtagtccgtctccacgatggtgatttccacgtccttttgcagcgtttccttgggcggggtaatgtccaagtttttaatcttgtacggacccgtcttcatttgcgcgttgcagtgctccgccgcaaaggcagaatgcgccgccgccgccaaaagcacatataaaacaatagcgcttaccatcttgcttgtgtgttccttattgaagccttggtgtgactgatttactagtagcattgaggcatcttatatacccgaccgttatctggcctacgtgacacaaggcacgttgttagattaataatcttatctttttatcttaattgataagattatttttatctggctgttataaaaacgggatcatgaacacggacgctcagtcgacatcgaacacgcgcaacttcatgtactctcccgacagcagtctggaggtggtcatcattaccaattcggacggcgatcacgatggctatctggaactaaccgccgccgccaaagtcatgtcaccttttcttagcaacggcagttcggccgtgtggaccaacgcggcgccctcgcacaaattgattaaaaacaataaaaattatattcatgtgtttggtttatttaaatatctgtcaaattacaatttaaataataaaaagcgtcctaaagagtattacacccttaaatcgattattagcgacttgcttatgggcgctcaaggcaaagtatttgatccgctttgcgaagtaaaaacgcaactgtgtgcgattcaggagagtctcaacgaggctatttcgattttgaacgttcatagcaacgatgcggccgccaacccgcctgcgccagacattaacaagttgcaagaactgatacaagatttgcagtctgaatacaataaaaaaattacctttaccactgatacaattttggagaatttaaaaaatataaaggatttaatgtgcctgaataaataataataagggttttgtacgatttcaacaatgaacttttgggccacgtttagcatttgtctggtgggttatttggtgtacgcgggacacttgaataacgagctacaagaaataaaatcaatattagtggtcatgtacgaatctatggaaaagcatttttccaatgtggtagacgaaattgattctcttaaaacggacacgtttatgatgttgagcaacttgcaaaataac 209|acgattcgaacgtgggacgcagttgtaaaaaatggcaaaaaaatatccaatctcgacgaaaaaattaacgtgttattaacaaaaaacggggtagttaacaacgtgctaaacgttcaataaacgcttatcactaagttaatatactaaaaatcacatagtcactacaatatttcaaaatatgaagccgacgaataacgttatgttcgacgacgcgtcggtcctttggatcgacacggactacatttatcaaaatttaaaaatgcctttgcaggcgtttcaacaacttttgttcaccattccatctaaacatagaaaaatgatcaacgatgcgggcggatcgtgtcataacacggtcaaatacatggtggacatttacggagcggccgttctggttttgcgaacgccttgctcgttcgccgaccagttgttgagcacatttattgcaaacaattatttgtgctacttttaccgtcgtcgccgatcacgatcacgctcacgatcacgctcgcgatcacgttctcctcattgcagacctcgttcgcgctctcctcattgcagacctcgttcgcgatctcggtcccggtctagatcgcggtcacgttcatcgtctcccaggcgagggcgtcgacaaatattcgacgcgctggaaaagattcgtcatcaaaacgacatgttgatgagcaacgtcaaccaaataaatctcaaccaaactaatcaatttttagaattgtccaacatgatgacgggcgtgcgcaatcaaaacgtgcagctcctcgcggcgttggaaaccgctaaagatgttattttgaccagattaaacacattgcttgccgagattacagactcgttacccgacttgacgtccatgttagataaattagctgaacaattgttggacgccatcaacacggtgcagcaaacctgcgcaacgagttgaacaacaccaactctattttgaccaatttagcgtcaagcgtcacaaacatcaacggtacgctcaacaatttgctagccgctatcgaaaacttagtaggcggcggcggcggtggcaattttaacgaagccgacagacaaaaactggacctcgtgtacactttggttaacgaaatcaaaaatatactcacgggaacgctgacaaaaaaataagcatgtccgacaaaacaccaacaaaaaagggtggcagccatgccatgacgttgcgagagcgcggcgtaacaaaacccccaaaaaagtctgaaaagttgcagcaatacaagaaagccatcgctgccgagcaaacgctgcgcaccacagcagatgtttcttctttgcagaaccccggggagagtgccgtttttcaagagttggaaagattagagaatgcagttgtagtattagaaaatgaacaaaaacgattgtat 209|cccatattagatacgcctcttgataattttattgtcgcattcgtgaatccgacgtatcccatggcctattttgtcaataccgattacaaattaaaactagaatgtgccagaatcagaagcgatttactttacaaaaacaaaaacgaagtcgctatcaacaggcctaagatatcgtcttttaaattgcaattgaacaacgtaattttagacactatagaaactattgaatacgatttacaaaataaagttctcacaattactgcacctgttcaagatcaagaactaagaaaatccattatttattttaatattttaaatagtgacagttgggaagtaccaaagtatatgaaaaaattgtttgatgaaatgcaattggaacctcccgtcattttaccattaggtctttagatttggtaaggctagcacgtcgacatcatgtttgcgtcgttgacctcagagcaaaagctgttattaaaaaaatataaatttaacaattatgtgaaaacgatcgagttgagtcaagcgcagttggctcattggcgttcaaacaaagatattcagccaaaacctttggatcgtgcagaaattttacgtgtcgaaaaggccaccaggggacaaagcaaaaatgagctgtggacgctattgcgtttggatcgcaacacagcgtctgcatcgtccaactcgtccggcaacatgttacaacgaccagcgcttttgtttggaaacgcgcaagaaagtcacgtcaaagaaaccaacggcatcatgttagaccacatgcgcgaaatcatagaaagtaaaattatgagcgcggtcgttgaaacggttttggattgcggcatgttctttagccccttgggtttgcacgccgcttcgcccgatgcgtatttttctctcgccgacggaacgtggatcccagtggaaataaaatgtccgtacaattaccgagacacgaccgtggagcagatgcgtgtcgagttggggaacggcaatcgcaagtatcgcgtgaaacacaccgcgctgttggttaacaagaaaggcacgccccagttcgaaatggtcaaaacggatgcgcattacaagcaaatgcaacggcagatgtatgtgatgaacgcgcctatgggcttttacgtggtcaaattcaaacaaaatttggtggtggtttctgtgccgcgcgacgaaacgttctgcaacaaagaactgtctacggaaaacaacgcgtacgtggcgtttgccgtggaaaactccaactgcgcgcgctaccaatgcgccgacaagcgacggctttcattcaaaacgcacagctgcaatcacaactatagtggtcaagaaatcgatgctatggtcgatcgcggaatatatttagattatggacatttaaaatgtgcgtactgtgattttag 209|ctcagacagtcgggaaacgtgcgattctgttttaaaacgcgagcacaccaactgcaaaagttttaacttgaaacataaaaactttgacaatcctacatactttgattatgttaaaagattgcaaagtttgctaaagagtcaccactttagaaacgacgctaaaacacttgcctattttggttactatttaactcatacaggaaccctgaagaccttttgctgcggatcgcaaaactcgtcgcccaccaaacacgatcatttaaacgactgtgtatattatttggaaataaaataaacctttatattatatataattcttttatttatacatttgtttatacaattttatttacgacaaatattgactcgttgttcagaaagtttaataagcttgtcaatttcttcggcttgcaaagggctgccaacgcgttcgttttgaatgcgcgtaatccggtttacggtattgttggcgcgaacaataaactcctcaactggcaaattaacaattttgtttgcgtactcattgtgcactgcggccaggttttgtagaatgttttcgggaaaaatggcaattctattaaatttgacatgtttttgattgtatacatagttttgatattcttccagcgtaggatatttgtttaaactcttgacgcattcaatgtacaatttgtgcagtgacaaaattctgttaaaatccaaacgagaacatttctcaaaagttatttcttgaccgttgaaatgtacactttgcaattgtttcaataaactgtcgtaaaaagtttttccttcttcaagcacaaacgcggggcgcatcgtgttatctacaacgcttatgtacttgtcaaaatcttcaattatatgatagaaatacaaatatctctccgcgtttatggacgtgtcgtttaaaacatgttcgtcaacaactccgttatgatttactttcaaaaatttcaaatcttgcaaagcgtccgcgttggtcaacttgttgataataaatttgtctttgcattcaaacgctctgtttgcaatccactccacagcgtccaaaacggacatgcgtttaaacatgttgatacgttttagacaatacgctcgtttttttaccgcctcaacgttcacgtccgtgtagtcgcaccattgcaggatttgcaacatgtcctcggcaaaatgcgcgaactgccgcagcttttcctttccaaaatgttgattgtcgtgtttaaaaagcaacgttgaaatttccgagacataccacaaagccgtgggcaattttactttgatcagcggctccatagccaggttgctgaacccgatcatgcattccgtgttgttaatgcggtaaatgacatagcgtttaaagtagtcctttacattatcgtcaatgtattctgcgtcgttta 209|tgtgcttgtacagcaaatagtacataaggcccgcgttaaacgcgacctttttagcgtcaaaatacgtgcacgccaacacgtaatcgttgtattcgtcgaattgctcgttgggcactatggcgcccgtaaaagggcgtctgctgcgcggtgacaaacgcgttccatgctgaatcaactgcttcaaactttccaaattataacaatattcaattgaatttttaatctctttattttggctccataaaagaggaaactcgagtcggcttttaaacttggtcaaactgccctgaattgtttcaaacaagttgtaatgtgttaacaatatggccggcacaccgctatcgttggctaaaatacaatcggggaatcgaatattttctacgttgctgtaatcgtacgcttcgtcgtcgtcgttggcaacaacatcgtcggtttcggcgttaacgctcgctaacttgttctgatagtgtaaatttttcattacatcaaaagcgtatgacttgttgcgattgtgcaaataatttatggccgtgctaatggtgctgtcgataattttatcaaaattgagaacatcggcgttatacaacgttttataaaattctgttgacttgaacgtgtttacaaactcatttttatttttaatctggtcaaaattcatactagaattgttagtttgtttgatttcgctgaatagccgctggcggagacgcttcagcttgtccacctcgtttaacacgttggcgtccgtcggcatggaattgataaatttgaaccgaacaaaagacagcagttcatcttttttcgatataaaattttcggttgtaatgatatcgtagttaaattctttggttaaattgacccattcgaccatttcatcgttgcgataaatcttgcagtccgagttgttgacaaacgccgaggcaacggacaaatcaatctgttccgtgttattattgatggcataaaacacaatgcgttcgaaactaaacggtttttcgtttagcaaatttttgcaaacgtttgcctcatttttggaaatttggccgtcggtcaccatgtacaaaagtttcaacttgccgtcgagcaagtttatattcttgtgaatccactttatgaattcgctgggcctggtgtcagtaccctcgccattgcggcgcaaataacgactcttgacgtctccgatttctttttggcggcaataagcactccaatgcaaatacaaaactttgtcgcaactactgatgttttcgatttcattctgaaattgttctaaagtttgtaacgcgttcttgttaaagtaatagtccgagtttgtcgacaaggaatcgtcggtggcgtacacgtagtagttaatcatcttgttgattgatatttaattttggcgacggatttttatatac 209|acgagcggagcggtcacgttctgtaacatgagtgatcgtgtgtgtgttatctctggcagcgcgatagtggtcgcgaaaattacacgcgcgtcgtaacgtgaacgtttatattataaatattcaacgttgcttgtattaagtgagcatttgagctttaccattgcaaaatgtgtgtaatttttccggtagaaatcgacgtgtcccagacgattattcgagattgtcaggtggacaaacaaaccagagagttggtgtacattaacaagattatgaacacgcaattgacaaaacccgttctcatgatgtttaacatttcgggtcctatacgaagcgttacgcgcaagaacaacaatttgcgcgacagaataaaatcaaaagtcgatgaacaatttgatcaactagaacgcgattacagcgatcaaatggatggattccacgatagcatcaagtattttaaagatgaacactattcggtaagttgccaaaatggcagcgtgttgaaaagcaagtttgctaaaattttaaagagtcatgattataccgataaaaagtctattgaagcttacgagaaatactgtttgcccaaattggtcgacgaacgcaacgactactacgtggcggtatgcgtgttgaagccgggatttgagaacggcagcaaccaagtgctatctttcgagtacaacccgattggtaacaaagttattgtgccgtttgctcacgaaattaacgacacgggactttacgagtacgacgtcgtagcttacgtggacagtgtgcagtttgatggcgaacaatttgaagagtttgtgcagagtttaatattgccgtcgtcgttcaaaaattcggaaaaggttttatattacaacgaagcgtcgaaaaacaaaagcatgatctacaaggctttagagtttactacagaatcgagctggggcaaatccgaaaagtataattggaaaattttttgtaacggttttatttatgataaaaaatcaaaagtgttgtatgttaaattgcacaatgtaactagtgcactcaacaaaaatgtaatattaaacacaattaaataaatgttaaaatttattgcctaatattattttgtcattgcttgtcatttattaatttggatgatgtcatttgtttttaaaattgaactggctttacgagtagaattctacgcgtaaaacacaatcaagtatgagtcataatctgatgtcatgttttgtacacggctcataaccgaactggctttacgagtagaattctacttgtaatgcacgatcagtggatgatgtcatttgtttttcaaatcgagatgatgtcatgttttgcacacggctcataaactcgctttacgagtagaattctacgtgtaacgcacgatcgattgatgagtcatttgt 209|tttgcaatatgatatcatacaatatgactcatttgtttttcaaaaccgaacttgatttacgggtagaattctacttgtaaagcacaatcaaaaagatgatgtcatttgtttttcaaaactgaactcgctttacgagtagaattctacgtgtaaaacacaatcaagaaatgatgtcatttgttataaaaataaaagctgatgtcatgttttgcacatggctcataactaaactcgctttacgggtagaattctacgcgtaaaacatgattgataattaaataattcatttgcaagctatacgttaaatcaaacggacgttatggaattgtataatattaaatatgcaattgatccaacaaataaaattgtaatagagcaagtcgacaatgtggacgcgtttgtgcatattttagaaccgggtcaagaagtgttcgacgaaacgctaagccagtaccaccaatttcctggcgtcgttagttcgattattttcccgcaactcgtgttaaacacaataattagcgttttgagcgaagacggcagtttgctcacgttgaaactcgaaaacacttgttttaattttcacgtgtgcaataaacgctttgtgtttggcaatttgccagcggcggtcgtgaataatgaaacgaagcaaaaactgcgcattggagctccaatttttgccggcaaaaagctggtttcggtcgtgacggcgtttcatcgtgttggcgaaaacgaatggctgttaccggtgacgggaattcgagaggcgtcccagctgtcgggacatatgaaggtgctgaacggcgtccgtgttgaaaaatggcgacccaacatgtccgtctacgggactgtgcaattgccgtacgataaaattaaacagcatgcgctcgagcaagaaaataaaacgccaaacgcgttggagtcttgtgtgctattttacaaagattcagaaatacgcatcacttacaacaagggggactatgaaattatgcatttgaggatgccgggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcatgtcaaagcctaacgttttgacgcaaattttagacgccgttacggaaactaacacaaaggttgacagtgttcaaactcagttaaacgggctggaagaatcattccagcttttggacggtttgcccgctcaattgaccgatcttaacactaagatctcagaaattcaatccatattgaccggcgacattgttccggatcttccagactcactaaagcctaagctgaaaacccaagcttttgaactcgattcagacgctcgtcgtggtaaacgcagttccaagtaaa 209|tgaatcgtttttaaaataacaaatcaattgttttataatattcgtacgattctttgattatgtaataaaatgtgatcattaggaagattacgaaaaatataaaaaatatgagttctgtgtgtataacaaatgctgtaaacgccacaattgtgtttgttgcaaataaacccagtattatttgattaaaattgttgttttctttgttcatagacaatagtgtgttttgcctaaacgtgtactgcataaactccatgcgagtgtatagcgagctagtggctaacgcttgccccaccaaagtagattcgtcaaaatcctcaatttcatcaccctcctccaagtttaacatttggccgtcggaattaacttctaaagatgccacataatctaataaatgaaatagagattcaaacgtggcgtcatcgtccgtttcgaccatttccgaaaagaactcgggcataaactctatgatttctctggacgtggtgttgtcgaaactctcaaagtacgcagtcaggaacgtgcgcgacatgtcgtcgggaaactcgcgcggaaacatgttgttgtaaccgaacgggtcccatagcgccaaaaccaaatctgccagcgtcaatagaatgagcacgatgccgacaatggagctggcttggatagcgattcgagttaacgctttggcagtcacggtcagcgttttgatggcgatcacgttgagcgagtgcactaacgcggctttgtaagtctctcccaacatgcgcacggtcacgcgccgagtcgtgctaagcaacatgtgtttcatggccggaatgagagaagtgttaatttttttcaacatgcttttaaacccggacattagcatatcaaagccaatgtccgtagcaataccgaaaacgagcgcgtaatcttccaaaaacgatgttataattgactccaagtcttggtcgctgattgaacggtcgagcgcctcgaaatgttcgacacgtgcacgttcgttaccgcggtaattgtatgcgatcggagttttagtaaagccggtttcggccgtgtacgtgatctggacgggcgacccgttgacgatcatgcccaaatcgtttagtgttggatttttgttaaaaagtttttcaaattccaagtctgtggcgttatcgcgcacgctgcgccattgcgctagtattgcgttggagtccacgttgggtcgtggcggtagtatgctggaaggcgctttgtaatcaaaatcgcgcagttcgctaaaaatgttgttggccagcattttgaaagtgacaaagatcgtgtcgcccagcacgaatccgatgagcgattcccaccatctaaacgaacaaccgccgttgaatagctctctgccgaaacgtcgacagtaggcttcgttgaattcgcctttaaagcgt 209|tcgggaaacaaggggtcgggatcgggccgaacgttaaaagccggcacatcgtccacgcccatgatcgtgtgttcttcggtgcgcaagtatgggctgttaaagtacattttggacagcgagtccactaagatgcatttgttgtcgagcgtgtatctaaactcggcagactgaacttgggtttcggcgccttcacgcatggccgccgccctgtccaggtggtagcacgcgggctgcgcgtaacccacgctagtctcggaggtctgcatgtacatgaacggcgtcgtgttggacacgacgccggtttcgtgaaacggatagcagctcatgcttacacacccgcgcttgctgaaagccagtttgacggccagcgctttgtcggccaatttcggcggcacataataatcgtcgtcacttgacgcgggacgcagcgtgtagtcgattagtatatgcggaaacctggtgcgccatctcgaaataaactcgagacgatgcatatgtatggcatacctactggcattagttaaatcgacggctgttaaaaccgccatgttatataggacttaaaataaacaacaatatataatgaaatatttattagattatattatagcaatacatttacatttattataacaatactttttatttaatctgattatattataacgatacatttttatttagacattgttatttacaatattaattaactttttatacatttttaaatcataatatataatcatttcgttgtgcatttcaaagcttttgatagcttcaaagtaatacatgaatttagagtattcaggaaaatgataaacgttggtaaacccgcatttggtacaatataacacgggatttttataatacagtttagtttttttacacaatttgcaatagttgttagttgtaggtttcaaaggaaacgtgattgcgccgtccaatacctgggtaaactttttgactttaacagtggcaaacacggttcctttgatacccgaaaatcggttgtcttgcagagcggccatcatttcgcttggctcttgaagtataaaacagttgacgtcatccaccacgtcgggtctggtgcacatgcttcggtagcgctgcaacactatattggtgtatgtttccctgagaacgagaccgccggtggtgctaagatcgattgtttgaatgcgctcgttgggctctttgtgatttcgaattatgcgccgaattatttcaaacactttgcagttgtgatcgtcaattctcaattctttaacttccgtcgtgtgctctaaacttacagggaaaatgtattggtaaaaaaacctctctctggctaaatagctgaggtcgaccaaattgatagaaggatatatttcgtacgaggtttttggaacgttgtgatatag 209|atagcatttttgacagcagatgtctatgcggtcaggatcgtccaacggcttttcgatgtgaaccacaacatacaaaaaccattcgcgcgtgttgtctttgaatctataattgcaagtggtgcatcgcgaatcgctcatgtgctccatagtcttcttgtatttcacaggcctgcttgcaaatttgcccgtcatgcgcatatctttgctgtttatgtagcccataatgtaattggtggaaaattttagcgtggctttcatgatgtcgcgttctaaatcgctcatgaaatgcatacgtagatcgcgctcttgtttgaaatccagtttgtcgctgtacgcgggcaaaccttcaaacttgttcccaaactcgggcggcacaaaatatccatcttttctgttgacgactggttttttacttacaatgctgctgtgctccaacggcttggccggagaggtgcacataggctgtttaggcggagagatgcgcgtaggtggtttgatgttagattttggcggcggacgaacaggcgacggcggcgagttggcggcaggcgctggcaaagatttggcacgacccttgcccccggtccttggcgcgtcaaaaatgttattctctcgaaaaaaacggttcattgtaactgttagttagcactcagaaatcaacacgatactgtgcacgttcagccatcgagaggctttatatatggaaaccttatctatagagataagattgtatatgcgtaggagagcctggtcacgtaggcactttgcgcacggcactagggctgtggaggggacaggctatataaagcccgtttgcccaactcgtaaatcagtatcaattgtgctccggcgcacacgctcgcttgcgcgccggatagtataagtaattgataacgggcaacgcaacatgataagaaccagcagtcacgtgctgaacgtccaggaaaatataatgacgtcaaactgtgcgtcatcgccatattcgtgcgaggcaacgtccgcttgcgcagaagctcagcaggtaatgatcgataactttgttttctttcacatgtacaacgccgacatacaaattgacgcaaagctgcaatgcggcgtgcgctcggccgcgtttgcaatgatcgacgataaacatttggaaatgtacaagcatagaatagagaataaatttttttattactatgatcaatgtgccgacattgccaaacccgaccgtctgcccgatgacgacggcgcgtgctgtcaccattttatttttgatgcccaacgtattattcaatgtattaaagagattgaaagcgcgtacggcgtgcgtgatcgcggcaatgtaatagtgttttatccgtacttgaaacagttgcgagacgcgttgaagctaattaaaaactcttttgcgtgtt 209|gttttaaaattataaattctatgcaaatgtacgtgaacgagttaatatcaaattgcctgttgtttattgaaaagctggaaactattaataaaactgttaaagttatgaatttgtttgtagacaatttggttttgtacgaatgcaatgtttgtaaagaaatatctacggatgaaagatttttaaagccaaaagaatgttgcgaatacgctatatgcaacgcgtgctgcgttaacatgtggaagacggccaccacgcacgcaaaatgtccagcgtgcaggacatcgtataaataagcacgcaacgcaaaatgagtggtggcggcaacttgttgactctggaaagagatcattttaaatatttatttttgaccagctattttgatttaaaagataatgaacatgttccttcagagcctatggcatttattcgcaattacttgaattgcacgtttgatttgctagacgatgccgtgctcatgaactatttcaattacttgcaaagcatgcaattgaaacatttggtgggcagcacgtcgacaaacattttcaagtttgtaaagccacaatttagatttgtgtgcgatcgcacaactgtggacattttagaatttgacacgcgcatgtacataaaacccggcacgcccgtgtacgccacgaacctgttcacgtccaatccccgcaagatgatggctttcctgtacgctgaatttggcaaggtgtttaaaaataaaatattcgtaaacatcaacaactacggctgcgtgttggcgggcagtgccggtttcttgttcgacgatgcgtacgtggattggaatggtgtgcgaatgtgtgcggcgccgcgattagataacaacatgcatccgttccgactgtatctactgggcgaggacatggctaagcactttgtcgataataatatactaccgccgcacccttctaacgcaaagactcgcaaaatcaacaattcaatgtttatgctgaaaaacttttacaaaggtctgccgctgttcaaatcaaagtacacggtggtgaacagcactaaaatcgtgacccgaaaacccaacgatatatttaatgagatagataaagaattaaatggcaactgtccgtttatcaagtttattcagcgcgactacatattcgacgcccagtttccgccagatttgcttgatttgctaaacgaatacatgaccaaaagctcgatcatgaaaataattaccaagtttgtgattgaagaaaaccccgctatgagcggtgaaatgtctcgcgagattattcttgatcgctactcagtagacaattatcgcaagctgtacataaaaatggaaataaccaaccagtttcctgtcatgtacgatcatgaatcgtcgtacatttttgtgagcaaagactttttgcaat 209|tgaaaggcactatgaacgcgttctacgcgcccaagcagcgtatattaagtattttggcggtgaatcgtttgtttggcgccacggaaacgatcgactttcatcccaacctgctcgtgtaccggcagagttcgccgccggtccgtttgacgggcgacgtgtatgttgttgataagaacgaaaaagtttttttggtcaaacacgtgttctcaaacacggtgcctgcatatcttttaataagaggtgattacgaaagttcgtctgacttgaaatcccttcgcgatttgaatccgtgggttcagaacacgcttctcaaattattaatccccgactcggtacaataatatgatttacactgatcccactactggcgctacgactagcacagacgtcgtccgtccacaaactatttaaacaggctaactccaaacatgttcttgaccatcttggctgtagtagtaattattgctttaataattatatttgttcaatctagcagtaatggaaacagctcggggggtaatgtacctccaaacgccctggggggttttgtaaatcctttaaacgctaccatgcgagctaatccctttatgaacacgcctcaaaggcaaatgttgtagataagtgtataaaaaatgaaacgtatcaaatgcaacaaagttcgaacggtcaccgagattgtaaacagcgatgaaaaaatccaaaagacctacgaattggctgaatttgatttaaaaaatctaagcagtttagaaagctatgaaactctaaaaattaaattggcgctcagcaaatacatggctatgctcagcaccctggaaatgactcaaccgctgttggaaatatttagaaacaaagcagacactcggcagattgccgccgtggtgtttagcacattagcttttatacacaatagattccatccccttgttactaattttactaacaaaatggagtttgtggtcactgaaaccaacgacacaagcattcccggagaacccattttgtttacggaaaacgaaggtgtgctgctgtgttccgtggacagaccgtctatcgttaaaatgctaagccgcgagtttgacaccgaggctttagtaaactttgaaaacgacaactgcaacgtgcggatagccaagacgtttggcgcctctaagcgcaaaaacacgacgcgcagcgatgattacgagtcaaataaacaacccaattacgatatggatttgagcgattttagcataactgaggttgaagccactcaatatttaactctgttgctgaccgtcgaacatgcctatttacattattatatttttaaaaattacggggtgtttgaatattgcaaatcgctaacggaccattcgctttttaccaacaaattgcgatcgacaatgagcacaaaaacg 209|tctaatttactgttaagcaaattcaaatttaccattgaagattttgacaaaataaactcaaattctgtaacatcagggtttaatatatataattttaataaataattaaataatatacaatgtttttattaattatatttttaatattaattaaaagtattaatatttaaaaaaatgaatcaaattcatctaaagtgtcacagcgataaaatttgtcctaaagggtattttggcctcaacgccgatccctatgattgcacggcgtattatctgtgtccgcataaagtgcaaatgttttgcgaattaaatcacgaatttgacttggactccgccagctgcaagcctatcgtgtacgatcacacgggcagcgggtgtacggctcgcatgtatagaaacttgttactatgaagagcgggtttccagttgcacaacactattatcgatttgcagttcgggacataaatgtttaaatatatcgatgtctttgtgatgcgcgcgacatttttgtaggttattgataaaatgaacggatacgttgcccgacattatcattaaatccttggcgtagaatttgtcgggtccattgtccgtgtgcgctagcatgcccgtaacggacctcgtacttttggcttcaaaggttttgcgcacagacaaaatgtgccacacttgcagctctgcatgtgtgcgcgttaccacaaatcccaacggcgcagtgtacttgttgtatgcaaataaatctcgataaaggcgcggcgcgcgaatgcagctgatcacgtacgctcctcgtgttccgttcaaggacggtgttatcgacctcagattaatgtttatcggccgactgttttcgtatccgctcaccaaacgcgtttttgcattaacattgtatgtcggcggatgttctatatctaatttgaataaataaacgataaccgcgttggttttagagggcataataaaagaaatattgttatcgtgttcgccattagggcagtataaattgacgttcatgttggatattgtttcagttgcaagttgacactggcggcgacaagatcgtgaacaaccaagtgactatgacgcaaattaattttaacgcgtcgtacaccagcgcttcgacgccgtcccgagcgtcgttcgacaacagctattcagagttttgtgataaacaacccaacgactatttaagttattataaccatcccaccccggatggagccgacacggtgatatctgacagcgagactgcggcagcttcaaactttttggcaagcgtcaactcgttaactgataatgatttagtggaatgtttgctcaagaccactgataatctcgaagaagcagttagttctgcttattattcggaatcccttgagcagcctgttgtggagcaaccatcgccc 209|agttctgcttatcatgcggaatcttttgagcattctgctggtgtgaaccaaccatcggcaactggaactaaacggaagctggacgaatacttggacaattcacaaggtgtggtgggccagtttaacaaaattaaattgaggcctaaatacaagaaaagcacaattcaaagctgtgcaacccttgaacagacaattaatcacaacacgaacatttgcacggtcgcttcaactcaagaaattacgcattattttactaatgattttgcgccgtatttaatgcgtttcgacgacaacgactacaattccaacaggttctccgaccatatgtccgaaactggttattacatgtttgtggttaaaaaaagtgaagtgaagccgtttgaaattatatttgccaagtacgtgagcaatgtggtttacgaatatacaaacaattattacatggtagataatcgcgtgtttgtggtaacttttgataaaattaggtttatgatttcgtacaatttggttaaagaaaccggcatagaaattcctcattctcaagatgtgtgcaacgacgagacggctgcacaaaattgtaaaaaatgccatttcgtcgatgtgcaccacacgtttaaagctgctctgacttcatattttaatttagatatgtattacgcgcaaaccacatttgtgactttgttacaatcgttgggcgaaagaaaatgtgggtttcttttgagcaagttgtacgaaatgtatcaagataaaaatttatttactttgcctattatgcttagtcgtaaagagagtaatgaaattgagactgcatctaataatttctttgtatcgccgtatgtgagtcaaatattaaagtattcggaaagtgtgcagtttcccgacaatcccccaaacaaatatgtggtggacaatttaaatttaattgttaacaaaaaaagtacgctcacgtacaaatacagcagcgtcgctaatcttttgtttaataattataaatatcatgacaatattgcgagtaataataacgcagaaaatttaaaaaaggttaagaaggaggacggcagcatgcacattgtcgaacagtatttgactcagaatgtagataatgtaaagggtcacaattttatagtattgtctttcaaaaacgaggagcgattgactatagctaagaaaaacaaagagttttattggatttctggcgaaattaaagatgtagacgttagtcaagtaattcaaaaatataatagatttaagcatcacatgtttgtaatcggtaaagtgaaccgaagagagagcactacattgcacaataatttgttaaaattgttagctttaatattacagggtctggttccgttgtccgacgctataacgtttgcggaacaaaaactaaattgtaaata 209|taaaaaattcgaatttaattaattatacatatattttgaatttaattaattatacatatattttatattatttttgtcttttattatcgaggggccgttgttggtgtggggttttgcatagaaataacaatgggagttggcgacgttgctgcgccaacaccacctcctcctcctcctttcatcatgtatctgtagataaaataaaatattaaacctaaaaacaagaccgcgcctatcaacaaaatgataggcattaacttgccgctgacgctgtcactaacgttggacgatttgccgactaaaccttcatcgcccagtaaccaatctagacccaagtcgccaactaaatcaccaaacgagtaaggttcgatgcacatgagtgtttggcccgcaggaagatcgctaatatctacgtattgaggcgaatctgggtcggcggacggatcgctgccgcgacaaactgttttttctacttcatagttgaatccttggcacatgttggttagttcgggcggattgttaggcaacaaggggtcgaatgggcaaatggtaacatccgactgatttagattggggtcttgacgacaagtgcgctgcaataacaagcaggcctcggcgatttctccggcgtctttaccttgcacataataacttccgccggtgttattgatggcgttgattatatcttgtactagtgtggcggcgctaaacaagaaatagccgccggtggccaagagtatgcccgttcctcctacttttaagctttgcatgtaactatgtagacgggggttttgctgcagtgcgttttgaacaccttcgggcgtgcgcacgttggtttccgggaagttttgtttgactgcattggatcgcgtctgcttggtgtggtaattaaagtctggcacgttgtccacgcgccgcaattggctcaatgagtttatttgagggtctgaaatgccctgaaatactccgcgtatgttggggacatcattgttacgagtaattctgtttatgtctgaagtgctcacaaactggttgttagatagttgatagcccggctgaaatctgttgtttccaatgttgcgtacactgggcgcgttgagcacatttgtgaaaccggcgggagtgcttgttaaaagacgcgtattatcagtaataaaactggcctgattaggatacaatttattgactgcgcgaagatttgaaaaaaaactcattttaaagcaaacttatttaataaatatatcacagtaaaggttttgcaaaactgccgtcgtcaatacaacacggcagcggcgtcatgttggtaaaatctaatcttctccttgctttagattctgggcgagaaggcgcatttgttgtgtaagttatttcgacgtctgcattatttgttgtgtaaggta 209|tctcgacgtatgaagcaactttaacattgttataattttttttaaatattgatgcgctccacggcgcgcgttgatacggatgatatctctccattgtatgatcgctaaatttatataccgtttcaataaatatgttaaaacccaacatgttaattataatattcataatagtttgtttgttttcaataattatttttactgttttgaaatctaaaagaggtgacgatgacgaatcagacgacgggttcagttgctataacaaaccaattggagtaaattttccgcatcctactagatgtgacgctttctacatgtgtgtcggtttaaatcaaaaattagagttaatctgccctgaaggatttgaatttgatccagatgttaaaaattgtgttcctatatcagattatggatgtaccgctaaccaaaactaaaaataaaataaaatttatatagattaatgaaataaaatttatatagattaataaaataaaatttatttaatatattatactatttatattatttacaacacttaacgtctagacataacagtttgtaacttagaaactaaatcagagttactgcgctcaaactctgaaaatttggcttgagactcggccacctgcttacgcaattgttcttgcagattattcacagtcgattgcaactcttctgatttcttggtagattcttgcaagtcatagtttgccttttgtaaatctaattcggcgacagcatgcttgtgtttaagcataatgtagtcgctgtttaacatggtcattttatgttcaacttggctggtcttggctcgcagctcggacagttctttttgcaattgctccacatagttcaagtccgtggtgtgattgttgaccgtgttattttctaaaagctcgcgccaatgctgtttgatggaatcctggttacgagtgacgttaatgggcataaattctacatacccgtgcttattgtacacgcgacaatctgatgaagtagcgctgcaaaaacatttgtacacagaattgtccataattatcttgacataacacttgaaacacacagcatggttacaatgaatcgaagtcacaaacgaggaatttacgtttttagtgtctttaaaagtagtaaaacaaatattacacgaaacctctacttcttcttcgggttctgattgctgctgctgctgctgctgcggctgcggagactgcggcgaggcaaacaaatctggcgactgtggtattacgtaattcggcgaataagatggactataagtgggagaccttggggcaatctcattcatcagctgagcctcaagatctaaacctcgttgcagagccctctgcgcagctgtctccgacgcaatgttatcctggtactgctgggcagtgatgtcgggaaac 209|cgttcacgatccacattttcactattaattagtatgacgtcatcctcttgacttaatagcggatcgtcattgctaatgttaacctgaccgtgcacgtaatacgtgacaccctgacgatggtaggtgcgcgtcaacggctcgttgacgttcccgataatctgcacgttttcttcgctgacacgctgctcctgacgccgctcctgacggcgatggctgcgactgcttgaagacggctggctgcgactgcttgaagacggctgggcttcgggagatgttgtaaagttgatgcggcgacggctgagagacagcctgtggcggcggctgctgctgggagtggcggcgttgatttggcgactcatggctgggctggtaggatactgttcactaggctgtgaggcttgaactgtgcttacgagtagaacggcagctgtatttatactgtttatcagtactgcacgactgataagacaatagtggtgggggaacttgccaggcaaaaatgaacttttttgtaatgcaaaaaagttgatagtgtagtagtatattgggagcgtatcgtacagtgtagactattctaataaaatagtctacgatttgtagagattgtactgtatatggagtgtcaggcaaaagtgaacttttttgcattgcaaaaaaattcattttaaatttatcatatcacaggctgcagtttctgttatctgtcccccactcaggcgtgcagctataaaagcaggcactcaccaactcgtaagcacagttcgttgtgaagtgaacacggagagcctgccaataagcaaaatgccaagggacaccaacaatcgccaccggtctacgccatatgaacgtcctacgcttgaagatctccgcagacagttgcaagacaatttggacagcataaaccgccgagacagaatgcaagaagaacaagaagaaaacctgcgctatcaagtgcgtagaaggcagcgtcaaaaccagctccgctccatacaaatggaacagcagcgaatgatggcggaattaaacaacgagccggtgattaattttaaatttgagtgtagtgtgtgtttagaaacatattcccaacaatctaacgatacttgtccttttttgattccgactacgtgcgaccacggtttttgtttcaaatgcgtcatcaatctgcaaagcaacgcgatgaatattccgcattccactgtgtgctgtccattgtgcaatacccaggtaaaaatgtggcgttccttaaagcctaacgctgttgtgacgtgtaagttttacaagaaaactcaagaaagagttccgcccgtgcagcagtataaaaacattattaaagtgctacaagaacggagcgtgattagtgtcgaagacaacgacaataattgtgacataaatatggagaa 209|tcaggcaaagatagctgctttggaagctgaattggaagaagaaaaaaatcacagtgatcaagtagcttctgaaaaccgacagctgatagaagaaaatactcgtctcaatgaacagattcaagagttgcagcatcaggtgaggacattggtgccgcaacgtggcattacggttaatcagcaaattggccgtgacgacagtgcgccagccgagctgaacgagcgttttcgctcacttgtctattcgactatttcagagctgtttattgaaaatggcgttcatagtattcaaaattatgtttatgccggaacttctgctgctagttcatgtgatgtaaatgttactgttaattttgggtttgaaaattaatgtgatatgaaatgtatatataaaaatgatggaataaataataaacatttttatactttttatgttttttttatttcatgtgattaagaaacttttaagatggatagtagtaattgtattaaaatagatgtaaaatacgatatgccgttacattatcaatgtgacaataacgcagataaagacgttgtaaatgcgtatgacactatcgatgttgaccccaacaaaagatttataattaatcataatcacgaacaacaacaagtcaatgaaacaaataaacaagttgtcgataaaacattcataaatgacacagcaacatacaattcttgcataataaaaatttaaatgacatcatatttgagaataacaaatgacattatccctcgattgtgttttacaagta 210 212 25|pAd/CMV/V5-DEST 278|GenBank 27|0 222|1 33|36686 236|38836800 237|326807313 26|872 28|0 219|0 220|1 221|1 29|0 30|1 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 726 53|0 55|1 56|36686 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="726" 50 45 51|97 52|Human Ad5 53|0 54|wt bases 1-458; includes 5' R-ITR and packaging signal 55|1 56|458 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1440000" 50 45 51|4 52|Amp(R) 53|1 55|35568 56|36428 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|1407 56|1531 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|3547 56|3671 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|1 55|36429 56|36527 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|1 55|1960 56|2265 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|1 55|2607 56|3266 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|CMV forward primer 53|0 55|1265 56|1285 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|728 56|1315 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2180000" 50 45 51|27 52|pAD forward primer 53|0 55|361 56|384 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2020000" 50 45 51|27 52|pAD reverse primer 53|1 55|4059 56|4082 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2030000" 50 45 51|33 52|pUC origin 53|1 55|34781 56|35442 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2530000" 50 45 51|27 52|T7 primer 53|0 55|1359 56|1378 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|1359 56|1375 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|25 52|TK pA 53|0 55|3765 56|4036 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1860000" 50 45 51|27 52|TK pA reverse primer 53|1 55|3772 56|3790 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2120000" 50 45 51|27 52|V5 reverse primer 53|1 55|3706 56|3726 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|3697 56|3738 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|97 52|Human Ad5 53|0 54|wt bases 3513-35935, E3 region deleted; includes 3'L-ITR 55|4056 56|34604 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1450000" 50 45 51|4 52|3 stops 53|0 55|3748 56|3756 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000001" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|catcatcaataatataccttattttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgtgggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaacacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacaggaagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagtaagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttgtgttactcatagcgcgtaatatttgtctagggccgcggggactttgaccgtttacgtggagactcgcccaggtgtttttctcaggtgttttccgcgttccgggtcaaagttggcgttttattattatagtcagtcgaagcttggatccggtacctctagaattctcgagcggccgctagcgacatcggatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaag 209|ctatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagtccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcacacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaa 209|aactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggttagtaatgagtttaaacgggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacgggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagaccccattggggccaatacgcccgcgtttcttccttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagcagatccgattcgacagatcactgaaatgtgtgggcgtggcttaagggtgggaaagaatatataaggtgggggtcttatgtagttttgtatctgttttgcagcagccgccgccgccatgagcaccaactcgtttgatggaagcattgtgagctcatatttgacaa 209|cgcgcatgcccccatgggccggggtgcgtcagaatgtgatgggctccagcattgatggtcgccccgtcctgcccgcaaactctactaccttgacctacgagaccgtgtctggaacgccgttggagactgcagcctccgccgccgcttcagccgctgcagccaccgcccgcgggattgtgactgactttgctttcctgagcccgcttgcaagcagtgcagcttcccgttcatccgcccgcgatgacaagttgacggctcttttggcacaattggattctttgacccgggaacttaatgtcgtttctcagcagctgttggatctgcgccagcaggtttctgccctgaaggcttcctcccctcccaatgcggtttaaaacataaataaaaaaccagactctgtttggatttggatcaagcaagtgtcttgctgtctttatttaggggttttgcgcgcgcggtaggcccgggaccagcggtctcggtcgttgagggtcctgtgtattttttccaggacgtggtaaaggtgactctggatgttcagatacatgggcataagcccgtctctggggtggaggtagcaccactgcagagcttcatgctgcggggtggtgttgtagatgatccagtcgtagcaggagcgctgggcgtggtgcctaaaaatgtctttcagtagcaagctgattgccaggggcaggcccttggtgtaagtgtttacaaagcggttaagctgggatgggtgcatacgtggggatatgagatgcatcttggactgtatttttaggttggctatgttcccagccatatccctccggggattcatgttgtgcagaaccaccagcacagtgtatccggtgcacttgggaaatttgtcatgtagcttagaaggaaatgcgtggaagaacttggagacgcccttgtgacctccaagattttccatgcattcgtccataatgatggcaatgggcccacgggcggcggcctgggcgaagatatttctgggatcactaacgtcatagttgtgttccaggatgagatcgtcataggccatttttacaaagcgcgggcggagggtgccagactgcggtataatggttccatccggcccaggggcgtagttaccctcacagatttgcatttcccacgctttgagttcagatggggggatcatgtctacctgcggggcgatgaagaaaacggtttccggggtaggggagatcagctgggaagaaagcaggttcctgagcagctgcgacttaccgcagccggtgggcccgtaaatcacacctattaccgggtgcaactggtagttaagagagctgcagctgccgtcatccctgagcaggggggccacttcgttaagcatgtccctgactcgcatgttttccctgaccaaatccgcc 209|agaaggcgctcgccgcccagcgatagcagttcttgcaaggaagcaaagtttttcaacggtttgagaccgtccgccgtaggcatgcttttgagcgtttgaccaagcagttccaggcggtcccacagctcggtcacctgctctacggcatctcgatccagcatatctcctcgtttcgcgggttggggcggctttcgctgtacggcagtagtcggtgctcgtccagacgggccagggtcatgtctttccacgggcgcagggtcctcgtcagcgtagtctgggtcacggtgaaggggtgcgctccgggctgcgcgctggccagggtgcgcttgaggctggtcctgctggtgctgaagcgctgccggtcttcgccctgcgcgtcggccaggtagcatttgaccatggtgtcatagtccagcccctccgcggcgtggcccttggcgcgcagcttgcccttggaggaggcgccgcacgaggggcagtgcagacttttgagggcgtagagcttgggcgcgagaaataccgattccggggagtaggcatccgcgccgcaggccccgcagacggtctcgcattccacgagccaggtgagctctggccgttcggggtcaaaaaccaggtttcccccatgctttttgatgcgtttcttacctctggtttccatgagccggtgtccacgctcggtgacgaaaaggctgtccgtgtccccgtatacagacttgagaggcctgtcctcgagcggtgttccgcggtcctcctcgtatagaaactcggaccactctgagacaaaggctcgcgtccaggccagcacgaaggaggctaagtgggaggggtagcggtcgttgtccactagggggtccactcgctccagggtgtgaagacacatgtcgccctcttcggcatcaaggaaggtgattggtttgtaggtgtaggccacgtgaccgggtgttcctgaaggggggctataaaagggggtgggggcgcgttcgtcctcactctcttccgcatcgctgtctgcgagggccagctgttggggtgagtactccctctgaaaagcgggcatgacttctgcgctaagattgtcagtttccaaaaacgaggaggatttgatattcacctggcccgcggtgatgcctttgagggtggccgcatccatctggtcagaaaagacaatctttttgttgtcaagcttggtggcaaacgacccgtagagggcgttggacagcaacttggcgatggagcgcagggtttggtttttgtcgcgatcggcgcgctccttggccgcgatgtttagctgcacgtattcgcgcgcaacgcaccgccattcgggaaagacggtggtgcgctcgtcgggcaccaggtgcacgcgccaaccgcggttgtgcagggtgacaaggtcaacg 209|ctggtggctacctctccgcgtaggcgctcgttggtccagcagaggcggccgcccttgcgcgagcagaatggcggtagggggtctagctgcgtctcgtccggggggtctgcgtccacggtaaagaccccgggcagcaggcgcgcgtcgaagtagtctatcttgcatccttgcaagtctagcgcctgctgccatgcgcgggcggcaagcgcgcgctcgtatgggttgagtgggggaccccatggcatggggtgggtgagcgcggaggcgtacatgccgcaaatgtcgtaaacgtagaggggctctctgagtattccaagatatgtagggtagcatcttccaccgcggatgctggcgcgcacgtaatcgtatagttcgtgcgagggagcgaggaggtcgggaccgaggttgctacgggcgggctgctctgctcggaagactatctgcctgaagatggcatgtgagttggatgatatggttggacgctggaagacgttgaagctggcgtctgtgagacctaccgcgtcacgcacgaaggaggcgtaggagtcgcgcagcttgttgaccagctcggcggtgacctgcacgtctagggcgcagtagtccagggtttccttgatgatgtcatacttatcctgtcccttttttttccacagctcgcggttgaggacaaactcttcgcggtctttccagtactcttggatcggaaacccgtcggcctccgaacggtaagagcctagcatgtagaactggttgacggcctggtaggcgcagcatcccttttctacgggtagcgcgtatgcctgcgcggccttccggagcgaggtgtgggtgagcgcaaaggtgtccctgaccatgactttgaggtactggtatttgaagtcagtgtcgtcgcatccgccctgctcccagagcaaaaagtccgtgcgctttttggaacgcggatttggcagggcgaaggtgacatcgttgaagagtatctttcccgcgcgaggcataaagttgcgtgtgatgcggaagggtcccggcacctcggaacggttgttaattacctgggcggcgagcacgatctcgtcaaagccgttgatgttgtggcccacaatgtaaagttccaagaagcgcgggatgcccttgatggaaggcaattttttaagttcctcgtaggtgagctcttcaggggagctgagcccgtgctctgaaagggcccagtctgcaagatgagggttggaagcgacgaatgagctccacaggtcacgggccattagcatttgcaggtggtcgcgaaaggtcctaaactggcgacctatggccattttttctggggtgatgcagtagaaggtaagcgggtcttgttcccagcggtcccatccaaggttcgcggctaggtctcgcgcggcagtcac 209|tagaggctcatctccgccgaacttcatgaccagcatgaagggcacgagctgcttcccaaaggcccccatccaagtataggtctctacatcgtaggtgacaaagagacgctcggtgcgaggatgcgagccgatcgggaagaactggatctcccgccaccaattggaggagtggctattgatgtggtgaaagtagaagtccctgcgacgggccgaacactcgtgctggcttttgtaaaaacgtgcgcagtactggcagcggtgcacgggctgtacatcctgcacgaggttgacctgacgaccgcgcacaaggaagcagagtgggaatttgagcccctcgcctggcgggtttggctggtggtcttctacttcggctgcttgtccttgaccgtctggctgctcgaggggagttacggtggatcggaccaccacgccgcgcgagcccaaagtccagatgtccgcgcgcggcggtcggagcttgatgacaacatcgcgcagatgggagctgtccatggtctggagctcccgcggcgtcaggtcaggcgggagctcctgcaggtttacctcgcatagacgggtcagggcgcgggctagatccaggtgatacctaatttccaggggctggttggtggcggcgtcgatggcttgcaagaggccgcatccccgcggcgcgactacggtaccgcgcggcgggcggtgggccgcgggggtgtccttggatgatgcatctaaaagcggtgacgcgggcgagcccccggaggtagggggggctccggacccgccgggagagggggcaggggcacgtcggcgccgcgcgcgggcaggagctggtgctgcgcgcgtaggttgctggcgaacgcgacgacgcggcggttgatctcctgaatctggcgcctctgcgtgaagacgacgggcccggtgagcttgagcctgaaagagagttcgacagaatcaatttcggtgtcgttgacggcggcctggcgcaaaatctcctgcacgtctcctgagttgtcttgataggcgatctcggccatgaactgctcgatctcttcctcctggagatctccgcgtccggctcgctccacggtggcggcgaggtcgttggaaatgcgggccatgagctgcgagaaggcgttgaggcctccctcgttccagacgcggctgtagaccacgcccccttcggcatcgcgggcgcgcatgaccacctgcgcgagattgagctccacgtgccgggcgaagacggcgtagtttcgcaggcgctgaaagaggtagttgagggtggtggcggtgtgttctgccacgaagaagtacataacccagcgtcgcaacgtggattcgttgatatcccccaaggcctcaaggcgctccatggcctcgtagaagtccacggcgaagttgaaaaa 209|ctgggagttgcgcgccgacacggttaactcctcctccagaagacggatgagctcggcgacagtgtcgcgcacctcgcgctcaaaggctacaggggcctcttcttcttcttcaatctcctcttccataagggcctccccttcttcttcttctggcggcggtgggggaggggggacacggcggcgacgacggcgcaccgggaggcggtcgacaaagcgctcgatcatctccccgcggcgacggcgcatggtctcggtgacggcgcggccgttctcgcgggggcgcagttggaagacgccgcccgtcatgtcccggttatgggttggcggggggctgccatgcggcagggatacggcgctaacgatgcatctcaacaattgttgtgtaggtactccgccgccgagggacctgagcgagtccgcatcgaccggatcggaaaacctctcgagaaaggcgtctaaccagtcacagtcgcaaggtaggctgagcaccgtggcgggcggcagcgggcggcggtcggggttgtttctggcggaggtgctgctgatgatgtaattaaagtaggcggtcttgagacggcggatggtcgacagaagcaccatgtccttgggtccggcctgctgaatgcgcaggcggtcggccatgccccaggcttcgttttgacatcggcgcaggtctttgtagtagtcttgcatgagcctttctaccggcacttcttcttctccttcctcttgtcctgcatctcttgcatctatcgctgcggcggcggcggagtttggccgtaggtggcgccctcttcctcccatgcgtgtgaccccgaagcccctcatcggctgaagcagggctaggtcggcgacaacgcgctcggctaatatggcctgctgcacctgcgtgagggtagactggaagtcatccatgtccacaaagcggtggtatgcgcccgtgttgatggtgtaagtgcagttggccataacggaccagttaacggtctggtgacccggctgcgagagctcggtgtacctgagacgcgagtaagccctcgagtcaaatacgtagtcgttgcaagtccgcaccaggtactggtatcccaccaaaaagtgcggcggcggctggcggtagaggggccagcgtagggtggccggggctccgggggcgagatcttccaacataaggcgatgatatccgtagatgtacctggacatccaggtgatgccggcggcggtggtggaggcgcgcggaaagtcgcggacgcggttccagatgttgcgcagcggcaaaaagtgctccatggtcgggacgctctggccggtcaggcgcgcgcaatcgttgacgctctagaccgtgcaaaaggagagcctgtaagcgggcactcttccgtggtctggtggataaattcgcaagg 209|gtatcatggcggacgaccggggttcgagccccgtatccggccgtccgccgtgatccatgcggttaccgcccgcgtgtcgaacccaggtgtgcgacgtcagacaacgggggagtgctccttttggcttccttccaggcgcggcggctgctgcgctagcttttttggccactggccgcgcgcagcgtaagcggttaggctggaaagcgaaagcattaagtggctcgctccctgtagccggagggttattttccaagggttgagtcgcgggacccccggttcgagtctcggaccggccggactgcggcgaacgggggtttgcctccccgtcatgcaagaccccgcttgcaaattcctccggaaacagggacgagccccttttttgcttttcccagatgcatccggtgctgcggcagatgcgcccccctcctcagcagcggcaagagcaagagcagcggcagacatgcagggcaccctcccctcctcctaccgcgtcaggaggggcgacatccgcggttgacgcggcagcagatggtgattacgaacccccgcggcgccgggcccggcactacctggacttggaggagggcgagggcctggcgcggctaggagcgccctctcctgagcggtacccaagggtgcagctgaagcgtgatacgcgtgaggcgtacgtgccgcggcagaacctgtttcgcgaccgcgagggagaggagcccgaggagatgcgggatcgaaagttccacgcagggcgcgagctgcggcatggcctgaatcgcgagcggttgctgcgcgaggaggactttgagcccgacgcgcgaaccgggattagtcccgcgcgcgcacacgtggcggccgccgacctggtaaccgcatacgagcagacggtgaaccaggagattaactttcaaaaaagctttaacaaccacgtgcgtacgcttgtggcgcgcgaggaggtggctataggactgatgcatctgtgggactttgtaagcgcgctggagcaaaacccaaatagcaagccgctcatggcgcagctgttccttatagtgcagcacagcagggacaacgaggcattcagggatgcgctgctaaacatagtagagcccgagggccgctggctgctcgatttgataaacatcctgcagagcatagtggtgcaggagcgcagcttgagcctggctgacaaggtggccgccatcaactattccatgcttagcctgggcaagttttacgcccgcaagatataccataccccttacgttcccatagacaaggaggtaaagatcgaggggttctacatgcgcatggcgctgaaggtgcttaccttgagcgacgacctgggcgtttatcgcaacgagcgcatccacaaggccgtgagcgtgagccggcggcgcgagctcagc 209|gaccgcgagctgatgcacagcctgcaaagggccctggctggcacgggcagcggcgatagagaggccgagtcctactttgacgcgggcgctgacctgcgctgggccccaagccgacgcgccctggaggcagctggggccggacctgggctggcggtggcacccgcgcgcgctggcaacgtcggcggcgtggaggaatatgacgaggacgatgagtacgagccagaggacggcgagtactaagcggtgatgtttctgatcagatgatgcaagacgcaacggacccggcggtgcgggcggcgctgcagagccagccgtccggccttaactccacggacgactggcgccaggtcatggaccgcatcatgtcgctgactgcgcgcaatcctgacgcgttccggcagcagccgcaggccaaccggctctccgcaattctggaagcggtggtcccggcgcgcgcaaaccccacgcacgagaaggtgctggcgatcgtaaacgcgctggccgaaaacagggccatccggcccgacgaggccggcctggtctacgacgcgctgcttcagcgcgtggctcgttacaacagcggcaacgtgcagaccaacctggaccggctggtgggggatgtgcgcgaggccgtggcgcagcgtgagcgcgcgcagcagcagggcaacctgggctccatggttgcactaaacgccttcctgagtacacagcccgccaacgtgccgcggggacaggaggactacaccaactttgtgagcgcactgcggctaatggtgactgagacaccgcaaagtgaggtgtaccagtctgggccagactattttttccagaccagtagacaaggcctgcagaccgtaaacctgagccaggctttcaaaaacttgcaggggctgtggggggtgcgggctcccacaggcgaccgcgcgaccgtgtctagcttgctgacgcccaactcgcgcctgttgctgctgctaatagcgcccttcacggacagtggcagcgtgtcccgggacacatacctaggtcacttgctgacactgtaccgcgaggccataggtcaggcgcatgtggacgagcatactttccaggagattacaagtgtcagccgcgcgctggggcaggaggacacgggcagcctggaggcaaccctaaactacctgctgaccaaccggcggcagaagatcccctcgttgcacagtttaaacagcgaggaggagcgcattttgcgctacgtgcagcagagcgtgagccttaacctgatgcgcgacggggtaacgcccagcgtggcgctggacatgaccgcgcgcaacatggaaccgggcatgtatgcctcaaaccggccgtttatcaaccgcctaatggactacttgcatcgcgcggccgccgtgaaccccgagtat 209|ttcaccaatgccatcttgaacccgcactggctaccgccccctggtttctacaccgggggattcgaggtgcccgagggtaacgatggattcctctgggacgacatagacgacagcgtgttttccccgcaaccgcagaccctgctagagttgcaacagcgcgagcaggcagaggcggcgctgcgaaaggaaagcttccgcaggccaagcagcttgtccgatctaggcgctgcggccccgcggtcagatgctagtagcccatttccaagcttgatagggtctcttaccagcactcgcaccacccgcccgcgcctgctgggcgaggaggagtacctaaacaactcgctgctgcagccgcagcgcgaaaaaaacctgcctccggcatttcccaacaacgggatagagagcctagtggacaagatgagtagatggaagacgtacgcgcaggagcacagggacgtgccaggcccgcgcccgcccacccgtcgtcaaaggcacgaccgtcagcggggtctggtgtgggaggacgatgactcggcagacgacagcagcgtcctggatttgggagggagtggcaacccgtttgcgcaccttcgccccaggctggggagaatgttttaaaaaaaaaaaagcatgatgcaaaataaaaaactcaccaaggccatggcaccgagcgttggttttcttgtattccccttagtatgcggcgcgcggcgatgtatgaggaaggtcctcctccctcctacgagagtgtggtgagcgcggcgccagtggcggcggcgctgggttctcccttcgatgctcccctggacccgccgtttgtgcctccgcggtacctgcggcctaccggggggagaaacagcatccgttactctgagttggcacccctattcgacaccacccgtgtgtacctggtggacaacaagtcaacggatgtggcatccctgaactaccagaacgaccacagcaactttctgaccacggtcattcaaaacaatgactacagcccgggggaggcaagcacacagaccatcaatcttgacgaccggtcgcactggggcggcgacctgaaaaccatcctgcataccaacatgccaaatgtgaacgagttcatgtttaccaataagtttaaggcgcgggtgatggtgtcgcgcttgcctactaaggacaatcaggtggagctgaaatacgagtgggtggagttcacgctgcccgagggcaactactccgagaccatgaccatagaccttatgaacaacgcgatcgtggagcactacttgaaagtgggcagacagaacggggttctggaaagcgacatcggggtaaagtttgacacccgcaacttcagactggggtttgaccccgtcactggtcttgtcatgcctggggtatatacaaacgaa 209|gccttccatccagacatcattttgctgccaggatgcggggtggacttcacccacagccgcctgagcaacttgttgggcatccgcaagcggcaacccttccaggagggctttaggatcacctacgatgatctggagggtggtaacattcccgcactgttggatgtggacgcctaccaggcgagcttgaaagatgacaccgaacagggcgggggtggcgcaggcggcagcaacagcagtggcagcggcgcggaagagaactccaacgcggcagccgcggcaatgcagccggtggaggacatgaacgatcatgccattcgcggcgacacctttgccacacgggctgaggagaagcgcgctgaggccgaagcagcggccgaagctgccgcccccgctgcgcaacccgaggtcgagaagcctcagaagaaaccggtgatcaaacccctgacagaggacagcaagaaacgcagttacaacctaataagcaatgacagcaccttcacccagtaccgcagctggtaccttgcatacaactacggcgaccctcagaccggaatccgctcatggaccctgctttgcactcctgacgtaacctgcggctcggagcaggtctactggtcgttgccagacatgatgcaagaccccgtgaccttccgctccacgcgccagatcagcaactttccggtggtgggcgccgagctgttgcccgtgcactccaagagcttctacaacgaccaggccgtctactcccaactcatccgccagtttacctctctgacccacgtgttcaatcgctttcccgagaaccagattttggcgcgcccgccagcccccaccatcaccaccgtcagtgaaaacgttcctgctctcacagatcacgggacgctaccgctgcgcaacagcatcggaggagtccagcgagtgaccattactgacgccagacgccgcacctgcccctacgtttacaaggccctgggcatagtctcgccgcgcgtcctatcgagccgcactttttgagcaagcatgtccatccttatatcgcccagcaataacacaggctggggcctgcgcttcccaagcaagatgtttggcggggccaagaagcgctccgaccaacacccagtgcgcgtgcgcgggcactaccgcgcgccctggggcgcgcacaaacgcggccgcactgggcgcaccaccgtcgatgacgccatcgacgcggtggtggaggaggcgcgcaactacacgcccacgccgccaccagtgtccacagtggacgcggccattcagaccgtggtgcgcggagcccggcgctatgctaaaatgaagagacggcggaggcgcgtagcacgtcgccaccgccgccgacccggcactgccgcccaacgcgcggcggcggccctgcttaaccg 209|cgcacgtcgcaccggccgacgggcggccatgcgggccgctcgaaggctggccgcgggtattgtcactgtgccccccaggtccaggcgacgagcggccgccgcagcagccgcggccattagtgctatgactcagggtcgcaggggcaacgtgtattgggtgcgcgactcggttagcggcctgcgcgtgcccgtgcgcacccgccccccgcgcaactagattgcaagaaaaaactacttagactcgtactgttgtatgtatccagcggcggcggcgcgcaacgaagctatgtccaagcgcaaaatcaaagaagagatgctccaggtcatcgcgccggagatctatggccccccgaagaaggaagagcaggattacaagccccgaaagctaaagcgggtcaaaaagaaaaagaaagatgatgatgatgaacttgacgacgaggtggaactgctgcacgctaccgcgcccaggcgacgggtacagtggaaaggtcgacgcgtaaaacgtgttttgcgacccggcaccaccgtagtctttacgcccggtgagcgctccacccgcacctacaagcgcgtgtatgatgaggtgtacggcgacgaggacctgcttgagcaggccaacgagcgcctcggggagtttgcctacggaaagcggcataaggacatgctggcgttgccgctggacgagggcaacccaacacctagcctaaagcccgtaacactgcagcaggtgctgcccgcgcttgcaccgtccgaagaaaagcgcggcctaaagcgcgagtctggtgacttggcacccaccgtgcagctgatggtacccaagcgccagcgactggaagatgtcttggaaaaaatgaccgtggaacctgggctggagcccgaggtccgcgtgcggccaatcaagcaggtggcgccgggactgggcgtgcagaccgtggacgttcagatacccactaccagtagcaccagtattgccaccgccacagagggcatggagacacaaacgtccccggttgcctcagcggtggcggatgccgcggtgcaggcggtcgctgcggccgcgtccaagacctctacggaggtgcaaacggacccgtggatgtttcgcgtttcagccccccggcgcccgcgcggttcgaggaagtacggcgccgccagcgcgctactgcccgaatatgccctacatccttccattgcgcctacccccggctatcgtggctacacctaccgccccagaagacgagcaactacccgacgccgaaccaccactggaacccgccgccgccgtcgccgtcgccagcccgtgctggccccgatttccgtgcgcagggtggctcgcgaaggaggcaggaccctggtgctgccaacagcgcgctaccaccccagcatcgtttaaaagccgg 209|tctttgtggttcttgcagatatggccctcacctgccgcctccgtttcccggtgccgggattccgaggaagaatgcaccgtaggaggggcatggccggccacggcctgacgggcggcatgcgtcgtgcgcaccaccggcggcggcgcgcgtcgcaccgtcgcatgcgcggcggtatcctgcccctccttattccactgatcgccgcggcgattggcgccgtgcccggaattgcatccgtggccttgcaggcgcagagacactgattaaaaacaagttgcatgtggaaaaatcaaaataaaaagtctggactctcacgctcgcttggtcctgtaactattttgtagaatggaagacatcaactttgcgtctctggccccgcgacacggctcgcgcccgttcatgggaaactggcaagatatcggcaccagcaatatgagcggtggcgccttcagctggggctcgctgtggagcggcattaaaaatttcggttccaccgttaagaactatggcagcaaggcctggaacagcagcacaggccagatgctgagggataagttgaaagagcaaaatttccaacaaaaggtggtagatggcctggcctctggcattagcggggtggtggacctggccaaccaggcagtgcaaaataagattaacagtaagcttgatccccgccctcccgtagaggagcctccaccggccgtggagacagtgtctccagaggggcgtggcgaaaagcgtccgcgccccgacagggaagaaactctggtgacgcaaatagacgagcctccctcgtacgaggaggcactaaagcaaggcctgcccaccacccgtcccatcgcgcccatggctaccggagtgctgggccagcacacacccgtaacgctggacctgcctccccccgccgacacccagcagaaacctgtgctgccaggcccgaccgccgttgttgtaacccgtcctagccgcgcgtccctgcgccgcgccgccagcggtccgcgatcgttgcggcccgtagccagtggcaactggcaaagcacactgaacagcatcgtgggtctgggggtgcaatccctgaagcgccgacgatgcttctgaatagctaacgtgtcgtatgtgtgtcatgtatgcgtccatgtcgccgccagaggagctgctgagccgccgcgcgcccgctttccaagatggctaccccttcgatgatgccgcagtggtcttacatgcacatctcgggccaggacgcctcggagtacctgagccccgggctggtgcagtttgcccgcgccaccgagacgtacttcagcctgaataacaagtttagaaaccccacggtggcgcctacgcacgacgtgaccacagaccggtcccagcgtttgacgctgcggttcatccctgtggac 209|cgtgaggatactgcgtactcgtacaaggcgcggttcaccctagctgtgggtgataaccgtgtgctggacatggcttccacgtactttgacatccgcggcgtgctggacaggggccctacttttaagccctactctggcactgcctacaacgccctggctcccaagggtgccccaaatccttgcgaatgggatgaagctgctactgctcttgaaataaacctagaagaagaggacgatgacaacgaagacgaagtagacgagcaagctgagcagcaaaaaactcacgtatttgggcaggcgccttattctggtataaatattacaaaggagggtattcaaataggtgtcgaaggtcaaacacctaaatatgccgataaaacatttcaacctgaacctcaaataggagaatctcagtggtacgaaactgaaattaatcatgcagctgggagagtccttaaaaagactaccccaatgaaaccatgttacggttcatatgcaaaacccacaaatgaaaatggagggcaaggcattcttgtaaagcaacaaaatggaaagctagaaagtcaagtggaaatgcaatttttctcaactactgaggcgaccgcaggcaatggtgataacttgactcctaaagtggtattgtacagtgaagatgtagatatagaaaccccagacactcatatttcttacatgcccactattaaggaaggtaactcacgagaactaatgggccaacaatctatgcccaacaggcctaattacattgcttttagggacaattttattggtctaatgtattacaacagcacgggtaatatgggtgttctggcgggccaagcatcgcagttgaatgctgttgtagatttgcaagacagaaacacagagctttcataccagcttttgcttgattccattggtgatagaaccaggtacttttctatgtggaatcaggctgttgacagctatgatccagatgttagaattattgaaaatcatggaactgaagatgaacttccaaattactgctttccactgggaggtgtgattaatacagagactcttaccaaggtaaaacctaaaacaggtcaggaaaatggatgggaaaaagatgctacagaattttcagataaaaatgaaataagagttggaaataattttgccatggaaatcaatctaaatgccaacctgtggagaaatttcctgtactccaacatagcgctgtatttgcccgacaagctaaagtacagtccttccaacgtaaaaatttctgataacccaaacacctacgactacatgaacaagcgagtggtggctcccgggttagtggactgctacattaaccttggagcacgctggtcccttgactatatggacaacgtcaacccatttaaccaccaccg 209|caatgctggcctgcgctaccgctcaatgttgctgggcaatggtcgctatgtgcccttccacatccaggtgcctcagaagttctttgccattaaaaacctccttctcctgccgggctcatacacctacgagtggaacttcaggaaggatgttaacatggttctgcagagctccctaggaaatgacctaagggttgacggagccagcattaagtttgatagcatttgcctttacgccaccttcttccccatggcccacaacaccgcctccacgcttgaggccatgcttagaaacgacaccaacgaccagtcctttaacgactatctctccgccgccaacatgctctaccctatacccgccaacgctaccaacgtgcccatatccatcccctcccgcaactgggcggctttccgcggctgggccttcacgcgccttaagactaaggaaaccccatcactgggctcgggctacgacccttattacacctactctggctctataccctacctagatggaaccttttacctcaaccacacctttaagaaggtggccattacctttgactcttctgtcagctggcctggcaatgaccgcctgcttacccccaacgagtttgaaattaagcgctcagttgacggggagggttacaacgttgcccagtgtaacatgaccaaagactggttcctggtacaaatgctagctaactacaacattggctaccagggcttctatatcccagagagctacaaggaccgcatgtactccttctttagaaacttccagcccatgagccgtcaggtggtggatgatactaaatacaaggactaccaacaggtgggcatcctacaccaacacaacaactctggatttgttggctaccttgcccccaccatgcgcgaaggacaggcctaccctgctaacttcccctatccgcttataggcaagaccgcagttgacagcattacccagaaaaagtttctttgcgatcgcaccctttggcgcatcccattctccagtaactttatgtccatgggcgcactcacagacctgggccaaaaccttctctacgccaactccgcccacgcgctagacatgacttttgaggtggatcccatggacgagcccacccttctttatgttttgtttgaagtctttgacgtggtccgtgtgcaccggccgcaccgcggcgtcatcgaaaccgtgtacctgcgcacgcccttctcggccggcaacgccacaacataaagaagcaagcaacatcaacaacagctgccgccatgggctccagtgagcaggaactgaaagccattgtcaaagatcttggttgtgggccatattttttgggcacctatgacaagcgctttccaggctttgtttctccacacaagctcgcctgcgccat 209|agtcaatacggccggtcgcgagactgggggcgtacactggatggcctttgcctggaacccgcactcaaaaacatgctacctctttgagccctttggcttttctgaccagcgactcaagcaggtttaccagtttgagtacgagtcactcctgcgccgtagcgccattgcttcttcccccgaccgctgtataacgctggaaaagtccacccaaagcgtacaggggcccaactcggccgcctgtggactattctgctgcatgtttctccacgcctttgccaactggccccaaactcccatggatcacaaccccaccatgaaccttattaccggggtacccaactccatgctcaacagtccccaggtacagcccaccctgcgtcgcaaccaggaacagctctacagcttcctggagcgccactcgccctacttccgcagccacagtgcgcagattaggagcgccacttctttttgtcacttgaaaaacatgtaaaaataatgtactagagacactttcaataaaggcaaatgcttttatttgtacactctcgggtgattatttacccccacccttgccgtctgcgccgtttaaaaatcaaaggggttctgccgcgcatcgctatgcgccactggcagggacacgttgcgatactggtgtttagtgctccacttaaactcaggcacaaccatccgcggcagctcggtgaagttttcactccacaggctgcgcaccatcaccaacgcgtttagcaggtcgggcgccgatatcttgaagtcgcagttggggcctccgccctgcgcgcgcgagttgcgatacacagggttgcagcactggaacactatcagcgccgggtggtgcacgctggccagcacgctcttgtcggagatcagatccgcgtccaggtcctccgcgttgctcagggcgaacggagtcaactttggtagctgccttcccaaaaagggcgcgtgcccaggctttgagttgcactcgcaccgtagtggcatcaaaaggtgaccgtgcccggtctgggcgttaggatacagcgcctgcataaaagccttgatctgcttaaaagccacctgagcctttgcgccttcagagaagaacatgccgcaagacttgccggaaaactgattggccggacaggccgcgtcgtgcacgcagcaccttgcgtcggtgttggagatctgcaccacatttcggccccaccggttcttcacgatcttggccttgctagactgctccttcagcgcgcgctgcccgttttcgctcgtcacatccatttcaatcacgtgctccttatttatcataatgcttccgtgtagacacttaagctcgccttcgatctcagcgcagcggtgcagccacaacgcgcagcccgtgggctcgtgatgcttgtagg 209|tcacctctgcaaacgactgcaggtacgcctgcaggaatcgccccatcatcgtcacaaaggtcttgttgctggtgaaggtcagctgcaacccgcggtgctcctcgttcagccaggtcttgcatacggccgccagagcttccacttggtcaggcagtagtttgaagttcgcctttagatcgttatccacgtggtacttgtccatcagcgcgcgcgcagcctccatgcccttctcccacgcagacacgatcggcacactcagcgggttcatcaccgtaatttcactttccgcttcgctgggctcttcctcttcctcttgcgtccgcataccacgcgccactgggtcgtcttcattcagccgccgcactgtgcgcttacctcctttgccatgcttgattagcaccggtgggttgctgaaacccaccatttgtagcgccacatcttctctttcttcctcgctgtccacgattacctctggtgatggcgggcgctcgggcttgggagaagggcgcttctttttcttcttgggcgcaatggccaaatccgccgccgaggtcgatggccgcgggctgggtgtgcgcggcaccagcgcgtcttgtgatgagtcttcctcgtcctcggactcgatacgccgcctcatccgcttttttgggggcgcccggggaggcggcggcgacggggacggggacgacacgtcctccatggttgggggacgtcgcgccgcaccgcgtccgcgctcgggggtggtttcgcgctgctcctcttcccgactggccatttccttctcctataggcagaaaaagatcatggagtcagtcgagaagaaggacagcctaaccgccccctctgagttcgccaccaccgcctccaccgatgccgccaacgcgcctaccaccttccccgtcgaggcacccccgcttgaggaggaggaagtgattatcgagcaggacccaggttttgtaagcgaagacgacgaggaccgctcagtaccaacagaggataaaaagcaagaccaggacaacgcagaggcaaacgaggaacaagtcgggcggggggacgaaaggcatggcgactacctagatgtgggagacgacgtgctgttgaagcatctgcagcgccagtgcgccattatctgcgacgcgttgcaagagcgcagcgatgtgcccctcgccatagcggatgtcagccttgcctacgaacgccacctattctcaccgcgcgtaccccccaaacgccaagaaaacggcacatgcgagcccaacccgcgcctcaacttctaccccgtatttgccgtgccagaggtgcttgccacctatcacatctttttccaaaactgcaagatacccctatcctgccgtgccaaccgcagccgagcggacaagcagctggccttgcggcagggc 209|gctgtcatacctgatatcgcctcgctcaacgaagtgccaaaaatctttgagggtcttggacgcgacgagaagcgcgcggcaaacgctctgcaacaggaaaacagcgaaaatgaaagtcactctggagtgttggtggaactcgagggtgacaacgcgcgcctagccgtactaaaacgcagcatcgaggtcacccactttgcctacccggcacttaacctaccccccaaggtcatgagcacagtcatgagtgagctgatcgtgcgccgtgcgcagcccctggagagggatgcaaatttgcaagaacaaacagaggagggcctacccgcagttggcgacgagcagctagcgcgctggcttcaaacgcgcgagcctgccgacttggaggagcgacgcaaactaatgatggccgcagtgctcgttaccgtggagcttgagtgcatgcagcggttctttgctgacccggagatgcagcgcaagctagaggaaacattgcactacacctttcgacagggctacgtacgccaggcctgcaagatctccaacgtggagctctgcaacctggtctcctaccttggaattttgcacgaaaaccgccttgggcaaaacgtgcttcattccacgctcaagggcgaggcgcgccgcgactacgtccgcgactgcgtttacttatttctatgctacacctggcagacggccatgggcgtttggcagcagtgcttggaggagtgcaacctcaaggagctgcagaaactgctaaagcaaaacttgaaggacctatggacggccttcaacgagcgctccgtggccgcgcacctggcggacatcattttccccgaacgcctgcttaaaaccctgcaacagggtctgccagacttcaccagtcaaagcatgttgcagaactttaggaactttatcctagagcgctcaggaatcttgcccgccacctgctgtgcacttcctagcgactttgtgcccattaagtaccgcgaatgccctccgccgctttggggccactgctaccttctgcagctagccaactaccttgcctaccactctgacataatggaagacgtgagcggtgacggtctactggagtgtcactgtcgctgcaacctatgcaccccgcaccgctccctggtttgcaattcgcagctgcttaacgaaagtcaaattatcggtacctttgagctgcagggtccctcgcctgacgaaaagtccgcggctccggggttgaaactcactccggggctgtggacgtcggcttaccttcgcaaatttgtacctgaggactaccacgcccacgagattaggttctacgaagaccaatcccgcccgccaaatgcggagcttaccgcctgcgtcattacccagggccacattcttggccaattgcaagccat 209|caacaaagcccgccaagagtttctgctacgaaagggacggggggtttacttggacccccagtccggcgaggagctcaacccaatccccccgccgccgcagccctatcagcagcagccgcgggcccttgcttcccaggatggcacccaaaaagaagctgcagctgccgccgccacccacggacgaggaggaatactgggacagtcaggcagaggaggttttggacgaggaggaggaggacatgatggaagactgggagagcctagacgaggaagcttccgaggtcgaagaggtgtcagacgaaacaccgtcaccctcggtcgcattcccctcgccggcgccccagaaatcggcaaccggttccagcatggctacaacctccgctcctcaggcgccgccggcactgcccgttcgccgacccaaccgtagatgggacaccactggaaccagggccggtaagtccaagcagccgccgccgttagcccaagagcaacaacagcgccaaggctaccgctcatggcgcgggcacaagaacgccatagttgcttgcttgcaagactgtgggggcaacatctccttcgcccgccgctttcttctctaccatcacggcgtggccttcccccgtaacatcctgcattactaccgtcatctctacagcccatactgcaccggcggcagcggcagcggcagcaacagcagcggccacacagaagcaaaggcgaccggatagcaagactctgacaaagcccaagaaatccacagcggcggcagcagcaggaggaggagcgctgcgtctggcgcccaacgaacccgtatcgacccgcgagcttagaaacaggatttttcccactctgtatgctatatttcaacagagcaggggccaagaacaagagctgaaaataaaaaacaggtctctgcgatccctcacccgcagctgcctgtatcacaaaagcgaagatcagcttcggcgcacgctggaagacgcggaggctctcttcagtaaatactgcgcgctgactcttaaggactagtttcgcgccctttctcaaatttaagcgcgaaaactacgtcatctccagcggccacacccggcgccagcacctgtcgtcagcgccattatgagcaaggaaattcccacgccctacatgtggagttaccagccacaaatgggacttgcggctggagctgcccaagactactcaacccgaataaactacatgagcgcgggaccccacatgatatcccgggtcaacggaatccgcgcccaccgaaaccgaattctcttggaacaggcggctattaccaccacacctcgtaataaccttaatccccgtagttggcccgctgccctggtgtaccaggaaagtcccgctcccaccactgtggtacttcccagagacgc 209|ccaggccgaagttcagatgactaactcaggggcgcagcttgcgggcggctttcgtcacagggtgcggtcgcccgggcagggtataactcacctgacaatcagagggcgaggtattcagctcaacgacgagtcggtgagctcctcgcttggtctccgtccggacgggacatttcagatcggcggcgccggccgtccttcattcacgcctcgtcaggcaatcctaactctgcagacctcgtcctctgagccgcgctctggaggcattggaactctgcaatttattgaggagtttgtgccatcggtctactttaaccccttctcgggacctcccggccactatccggatcaatttattcctaactttgacgcggtaaaggactcggcggacggctacgactgaatgttaagtggagaggcagagcaactgcgcctgaaacacctggtccactgtcgccgccacaagtgctttgcccgcgactccggtgagttttgctactttgaattgcccgaggatcatatcgagggcccggcgcacggcgtccggcttaccgcccagggagagcttgcccgtagcctgattcgggagtttacccagcgccccctgctagttgagcgggacaggggaccctgtgttctcactgtgatttgcaactgtcctaaccttggattacatcaagatctttgttgccatctctgtgctgagtataataaatacagaaattaaaatatactggggctcctatcgccatcctgtaaacgccaccgtcttcacccgcccaagcaaaccaaggcgaaccttacctggtacttttaacatctctccctctgtgatttacaacagtttcaacccagacggagtgagtctacgagagaacctctccgagctcagctactccatcagaaaaaacaccaccctccttacctgccgggaacgtacgagtgcgtcaccggccgctgcaccacacctaccgcctgaccgtaaaccagactttttccggacagacctcaataactctgtttaccagaacaggaggtgagcttagaaaacccttagggtattaggccaaaggcgcagctactgtggggtttatgaacaattcaagcaactctacgggctattctaattcaggtttctctagaaatggacggaattattacagagcagcgcctgctagaaagacgcagggcagcggccgagcaacagcgcatgaatcaagagctccaagacatggttaacttgcaccagtgcaaaaggggtatcttttgtctggtaaagcaggccaaagtcacctacgacagtaataccaccggacaccgccttagctacaagttgccaaccaagcgtcagaaattggtggtcatggtgggagaaaagcccattaccataactcagcactcgg 209|tagaaaccgaaggctgcattcactcaccttgtcaaggacctgaggatctctgcacccttattaagaccctgtgcggtctcaaagatcttattccctttaactaataaaaaaaaataataaagcatcacttacttaaaatcagttagcaaatttctgtccagtttattcagcagcacctccttgccctcctcccagctctggtattgcagcttcctcctggctgcaaactttctccacaatctaaatggaatgtcagtttcctcctgttcctgtccatccgcacccactatcttcatgttgttgcagatgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctggggtactctctttgcgcctatccgaacctctagttacctccaatggcatgcttgcgctcaaaatgggcaacggcctctctctggacgaggccggcaaccttacctcccaaaatgtaaccactgtgagcccacctctcaaaaaaaccaagtcaaacataaacctggaaatatctgcacccctcacagttacctcagaagccctaactgtggctgccgccgcacctctaatggtcgcgggcaacacactcaccatgcaatcacaggccccgctaaccgtgcacgactccaaacttagcattgccacccaaggacccctcacagtgtcagaaggaaagctagccctgcaaacatcaggccccctcaccaccaccgatagcagtacccttactatcactgcctcaccccctctaactactgccactggtagcttgggcattgacttgaaagagcccatttatacacaaaatggaaaactaggactaaagtacggggctcctttgcatgtaacagacgacctaaacactttgaccgtagcaactggtccaggtgtgactattaataatacttccttgcaaactaaagttactggagccttgggttttgattcacaaggcaatatgcaacttaatgtagcaggaggactaaggattgattctcaaaacagacgccttatacttgatgttagttatccgtttgatgctcaaaaccaactaaatctaagactaggacagggccctctttttataaactcagcccacaacttggatattaactacaacaaaggcctttacttgtttacagcttcaaacaattccaaaaagcttgaggttaacctaagcactgccaaggggttgatgtttgacgctacagccatagccattaatgcaggagatgggcttgaatttggttcacctaatgcaccaaacacaaatcccctcaaaacaaaaattggccatggcct 209|agaatttgattcaaacaaggctatggttcctaaactaggaactggccttagttttgacagcacaggtgccattacagtaggaaacaaaaataatgataagctaactttgtggaccacaccagctccatctcctaactgtagactaaatgcagagaaagatgctaaactcactttggtcttaacaaaatgtggcagtcaaatacttgctacagtttcagttttggctgttaaaggcagtttggctccaatatctggaacagttcaaagtgctcatcttattataagatttgacgaaaatggagtgctactaaacaattccttcctggacccagaatattggaactttagaaatggagatcttactgaaggcacagcctatacaaacgctgttggatttatgcctaacctatcagcttatccaaaatctcacggtaaaactgccaaaagtaacattgtcagtcaagtttacttaaacggagacaaaactaaacctgtaacactaaccattacactaaacggtacacaggaaacaggagacacaactccaagtgcatactctatgtcattttcatgggactggtctggccacaactacattaatgaaatatttgccacatcctcttacactttttcatacattgcccaagaataaagaatcgtttgtgttatgtttcaacgtgtttatttttcaattgcagaaaatttcgaatcatttttcattcagtagtatagccccaccaccacatagcttatacagatcaccgtaccttaatcaaactcacagaaccctagtattcaacctgccacctccctcccaacacacagagtacacagtcctttctccccggctggccttaaaaagcatcatatcatgggtaacagacatattcttaggtgttatattccacacggtttcctgtcgagccaaacgctcatcagtgatattaataaactccccgggcagctcacttaagttcatgtcgctgtccagctgctgagccacaggctgctgtccaacttgcggttgcttaacgggcggcgaaggagaagtccacgcctacatgggggtagagtcataatcgtgcatcaggatagggcggtggtgctgcagcagcgcgcgaataaactgctgccgccgccgctccgtcctgcaggaatacaacatggcagtggtctcctcagcgatgattcgcaccgcccgcagcataaggcgccttgtcctccgggcacagcagcgcaccctgatctcacttaaatcagcacagtaactgcagcacagcaccacaatattgttcaaaatcccacagtgcaaggcgctgtatccaaagctcatggcggggaccacagaacccacgtggccatcataccacaagcgcaggtagattaagtggcgacccctc 209|ataaacacgctggacataaacattacctcttttggcatgttgtaattcaccacctcccggtaccatataaacctctgattaaacatggcgccatccaccaccatcctaaaccagctggccaaaacctgcccgccggctatacactgcagggaaccgggactggaacaatgacagtggagagcccaggactcgtaaccatggatcatcatgctcgtcatgatatcaatgttggcacaacacaggcacacgtgcatacacttcctcaggattacaagctcctcccgcgttagaaccatatcccagggaacaacccattcctgaatcagcgtaaatcccacactgcagggaagacctcgcacgtaactcacgttgtgcattgtcaaagtgttacattcgggcagcagcggatgatcctccagtatggtagcgcgggtttctgtctcaaaaggaggtagacgatccctactgtacggagtgcgccgagacaaccgagatcgtgttggtcgtagtgtcatgccaaatggaacgccggacgtagtcatatttcctgaagcaaaaccaggtgcgggcgtgacaaacagatctgcgtctccggtctcgccgcttagatcgctctgtgtagtagttgtagtatatccactctctcaaagcatccaggcgccccctggcttcgggttctatgtaaactccttcatgcgccgctgccctgataacatccaccaccgcagaataagccacacccagccaacctacacattcgttctgcgagtcacacacgggaggagcgggaagagctggaagaaccatgtttttttttttattccaaaagattatccaaaacctcaaaatgaagatctattaagtgaacgcgctcccctccggtggcgtggtcaaactctacagccaaagaacagataatggcatttgtaagatgttgcacaatggcttccaaaaggcaaacggccctcacgtccaagtggacgtaaaggctaaacccttcagggtgaatctcctctataaacattccagcaccttcaaccatgcccaaataattctcatctcgccaccttctcaatatatctctaagcaaatcccgaatattaagtccggccattgtaaaaatctgctccagagcgccctccaccttcagcctcaagcagcgaatcatgattgcaaaaattcaggttcctcacagacctgtataagattcaaaagcggaacattaacaaaaataccgcgatcccgtaggtcccttcgcagggccagctgaacataatcgtgcaggtctgcacggaccagcgcggccacttccccgccaggaaccttgacaaaagaacccacactgattatgacacgcatactcggagctatgctaaccagcgtagccccgatgtaagctt 209|tgttgcatgggcggcgatataaaatgcaaggtgctgctcaaaaaatcaggcaaagcctcgcgcaaaaaagaaagcacatcgtagtcatgctcatgcagataaaggcaggtaagctccggaaccaccacagaaaaagacaccatttttctctcaaacatgtctgcgggtttctgcataaacacaaaataaaataacaaaaaaacatttaaacattagaagcctgtcttacaacaggaaaaacaacccttataagcataagacggactacggccatgccggcgtgaccgtaaaaaaactggtcaccgtgattaaaaagcaccaccgacagctcctcggtcatgtccggagtcataatgtaagactcggtaaacacatcaggttgattcacatcggtcagtgctaaaaagcgaccgaaatagcccgggggaatacatacccgcaggcgtagagacaacattacagcccccataggaggtataacaaaattaataggagagaaaaacacataaacacctgaaaaaccctcctgcctaggcaaaatagcaccctcccgctccagaacaacatacagcgcttccacagcggcagccataacagtcagccttaccagtaaaaaagaaaacctattaaaaaaacaccactcgacacggcaccagctcaatcagtcacagtgtaaaaaagggccaagtgcagagcgagtatatataggactaaaaaatgacgtaacggttaaagtccacaaaaaacacccagaaaaccgcacgcgaacctacgcccagaaacgaaagccaaaaaacccacaacttcctcaaatcgtcacttccgttttcccacgttacgtcacttcccattttaagaaaactacaattcccaacacatacaagttactccgccctaaaacctacgtcacccgccccgttcccacgccccgcgccacgtcacaaactccaccccctcattatcatattggcttcaatccaaaataaggtatattattgatgatgttaattaatttaaatccgcatgcgatatcgagctctcccgggaattcggatctgcgacgcgaggctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggtagatgacgaccatcagggacagcttcacggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctccctt 209|cgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgntgcaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaacacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataa 209|gggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtcttcaaggatccgaattcccgggagagctcgatatcgcatgcggatttaaattaattaa 210 212 25|pAd/PL-DEST 278|GenBank 27|0 222|1 33|34864 236|38836800 237|326807313 26|873 28|0 219|0 220|1 221|1 29|0 30|1 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 728 53|0 55|1 56|34864 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="728" 50 45 51|97 52|Human Ad5 53|0 54|wt bases 1-458; includes 5' R-ITR and packaging signal 55|1 56|458 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1440000" 50 45 51|4 52|Amp(R) 53|1 55|33746 56|34606 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|512 56|636 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2092 56|2216 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|1 55|34607 56|34705 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1746 56|2051 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|745 56|1404 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|pAD forward primer 53|0 55|361 56|384 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2020000" 50 45 51|27 52|pAD reverse primer 53|1 55|2237 56|2260 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2030000" 50 45 51|33 52|pUC origin 53|1 55|32959 56|33620 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2530000" 50 45 51|97 52|Human Ad5 53|0 54|wt bases 3513-35935, E3 region deleted; includes 3' R-ITR 55|2234 56|32782 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1450000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|catcatcaataatataccttattttggattgaagccaatatgataatgagggggtggagtttgtgacgtggcgcggggcgtgggaacggggcgggtgacgtagtagtgtggcggaagtgtgatgttgcaagtgtggcggaacacatgtaagcgacggatgtggcaaaagtgacgtttttggtgtgcgccggtgtacacaggaagtgacaattttcgcgcggttttaggcggatgttgtagtaaatttgggcgtaaccgagtaagatttggccattttcgcgggaaaactgaataagaggaagtgaaatctgaataattttgtgttactcatagcgcgtaatatttgtctagggccgcggggactttgaccgtttacgtggagactcgcccaggtgtttttctcaggtgttttccgcgttccgggtcaaagttggcgttttattattatagtcagtcgaagcttggatccggtacctctagaattctcgagcggccgctagcgacatcgatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggc 209|gtaaacgcgtggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgatcgattcgacagatcactgaaatgtgtgggcgtggcttaagggtgggaaagaatatataaggtgggggtcttatgtagttttgtatctgttttgcagcagccgccgccgccatgagcaccaactcgtttgatggaagcattgtgagctcatatttgacaacgcgcatgcccccatgggccggggtgcgtcagaatgtgatgggctccagcattgatggtcgccccgtcctgcccgcaaactctactaccttgacctacgagaccgtgtctggaacgccgttggagactgcagcctccgccgccgcttcagccgctgcagccaccgcccgcgggattgtgactgactttgctttcctgagcccgcttgcaagcagtgcagcttcccgttcatccgcccgcgatgacaagttgacggctcttttggcacaattggattctttgacccgggaacttaatgtcgtttctcagcagctgttggatctgcgccagcaggtttctgccctgaaggcttcctcccctcccaatgcggtttaaaacataaataaaaaaccagactctgtttggatttggatcaagcaagtg 209|tcttgctgtctttatttaggggttttgcgcgcgcggtaggcccgggaccagcggtctcggtcgttgagggtcctgtgtattttttccaggacgtggtaaaggtgactctggatgttcagatacatgggcataagcccgtctctggggtggaggtagcaccactgcagagcttcatgctgcggggtggtgttgtagatgatccagtcgtagcaggagcgctgggcgtggtgcctaaaaatgtctttcagtagcaagctgattgccaggggcaggcccttggtgtaagtgtttacaaagcggttaagctgggatgggtgcatacgtggggatatgagatgcatcttggactgtatttttaggttggctatgttcccagccatatccctccggggattcatgttgtgcagaaccaccagcacagtgtatccggtgcacttgggaaatttgtcatgtagcttagaaggaaatgcgtggaagaacttggagacgcccttgtgacctccaagattttccatgcattcgtccataatgatggcaatgggcccacgggcggcggcctgggcgaagatatttctgggatcactaacgtcatagttgtgttccaggatgagatcgtcataggccatttttacaaagcgcgggcggagggtgccagactgcggtataatggttccatccggcccaggggcgtagttaccctcacagatttgcatttcccacgctttgagttcagatggggggatcatgtctacctgcggggcgatgaagaaaacggtttccggggtaggggagatcagctgggaagaaagcaggttcctgagcagctgcgacttaccgcagccggtgggcccgtaaatcacacctattaccgggtgcaactggtagttaagagagctgcagctgccgtcatccctgagcaggggggccacttcgttaagcatgtccctgactcgcatgttttccctgaccaaatccgccagaaggcgctcgccgcccagcgatagcagttcttgcaaggaagcaaagtttttcaacggtttgagaccgtccgccgtaggcatgcttttgagcgtttgaccaagcagttccaggcggtcccacagctcggtcacctgctctacggcatctcgatccagcatatctcctcgtttcgcgggttggggcggctttcgctgtacggcagtagtcggtgctcgtccagacgggccagggtcatgtctttccacgggcgcagggtcctcgtcagcgtagtctgggtcacggtgaaggggtgcgctccgggctgcgcgctggccagggtgcgcttgaggctggtcctgctggtgctgaagcgctgccggtcttcgccctgcgcgtcggccaggtagcatttgaccatggtgtcatagtccagcccctcc 209|gcggcgtggcccttggcgcgcagcttgcccttggaggaggcgccgcacgaggggcagtgcagacttttgagggcgtagagcttgggcgcgagaaataccgattccggggagtaggcatccgcgccgcaggccccgcagacggtctcgcattccacgagccaggtgagctctggccgttcggggtcaaaaaccaggtttcccccatgctttttgatgcgtttcttacctctggtttccatgagccggtgtccacgctcggtgacgaaaaggctgtccgtgtccccgtatacagacttgagaggcctgtcctcgagcggtgttccgcggtcctcctcgtatagaaactcggaccactctgagacaaaggctcgcgtccaggccagcacgaaggaggctaagtgggaggggtagcggtcgttgtccactagggggtccactcgctccagggtgtgaagacacatgtcgccctcttcggcatcaaggaaggtgattggtttgtaggtgtaggccacgtgaccgggtgttcctgaaggggggctataaaagggggtgggggcgcgttcgtcctcactctcttccgcatcgctgtctgcgagggccagctgttggggtgagtactccctctgaaaagcgggcatgacttctgcgctaagattgtcagtttccaaaaacgaggaggatttgatattcacctggcccgcggtgatgcctttgagggtggccgcatccatctggtcagaaaagacaatctttttgttgtcaagcttggtggcaaacgacccgtagagggcgttggacagcaacttggcgatggagcgcagggtttggtttttgtcgcgatcggcgcgctccttggccgcgatgtttagctgcacgtattcgcgcgcaacgcaccgccattcgggaaagacggtggtgcgctcgtcgggcaccaggtgcacgcgccaaccgcggttgtgcagggtgacaaggtcaacgctggtggctacctctccgcgtaggcgctcgttggtccagcagaggcggccgcccttgcgcgagcagaatggcggtagggggtctagctgcgtctcgtccggggggtctgcgtccacggtaaagaccccgggcagcaggcgcgcgtcgaagtagtctatcttgcatccttgcaagtctagcgcctgctgccatgcgcgggcggcaagcgcgcgctcgtatgggttgagtgggggaccccatggcatggggtgggtgagcgcggaggcgtacatgccgcaaatgtcgtaaacgtagaggggctctctgagtattccaagatatgtagggtagcatcttccaccgcggatgctggcgcgcacgtaatcgtatagttcgtgcgagggagcgaggaggtcgggaccgaggttgctacgggcgggctg 209|ctctgctcggaagactatctgcctgaagatggcatgtgagttggatgatatggttggacgctggaagacgttgaagctggcgtctgtgagacctaccgcgtcacgcacgaaggaggcgtaggagtcgcgcagcttgttgaccagctcggcggtgacctgcacgtctagggcgcagtagtccagggtttccttgatgatgtcatacttatcctgtcccttttttttccacagctcgcggttgaggacaaactcttcgcggtctttccagtactcttggatcggaaacccgtcggcctccgaacggtaagagcctagcatgtagaactggttgacggcctggtaggcgcagcatcccttttctacgggtagcgcgtatgcctgcgcggccttccggagcgaggtgtgggtgagcgcaaaggtgtccctgaccatgactttgaggtactggtatttgaagtcagtgtcgtcgcatccgccctgctcccagagcaaaaagtccgtgcgctttttggaacgcggatttggcagggcgaaggtgacatcgttgaagagtatctttcccgcgcgaggcataaagttgcgtgtgatgcggaagggtcccggcacctcggaacggttgttaattacctgggcggcgagcacgatctcgtcaaagccgttgatgttgtggcccacaatgtaaagttccaagaagcgcgggatgcccttgatggaaggcaattttttaagttcctcgtaggtgagctcttcaggggagctgagcccgtgctctgaaagggcccagtctgcaagatgagggttggaagcgacgaatgagctccacaggtcacgggccattagcatttgcaggtggtcgcgaaaggtcctaaactggcgacctatggccattttttctggggtgatgcagtagaaggtaagcgggtcttgttcccagcggtcccatccaaggttcgcggctaggtctcgcgcggcagtcactagaggctcatctccgccgaacttcatgaccagcatgaagggcacgagctgcttcccaaaggcccccatccaagtataggtctctacatcgtaggtgacaaagagacgctcggtgcgaggatgcgagccgatcgggaagaactggatctcccgccaccaattggaggagtggctattgatgtggtgaaagtagaagtccctgcgacgggccgaacactcgtgctggcttttgtaaaaacgtgcgcagtactggcagcggtgcacgggctgtacatcctgcacgaggttgacctgacgaccgcgcacaaggaagcagagtgggaatttgagcccctcgcctggcgggtttggctggtggtcttctacttcggctgcttgtccttgaccgtctggctgctcgaggggagttacggtggatcgga 209|ccaccacgccgcgcgagcccaaagtccagatgtccgcgcgcggcggtcggagcttgatgacaacatcgcgcagatgggagctgtccatggtctggagctcccgcggcgtcaggtcaggcgggagctcctgcaggtttacctcgcatagacgggtcagggcgcgggctagatccaggtgatacctaatttccaggggctggttggtggcggcgtcgatggcttgcaagaggccgcatccccgcggcgcgactacggtaccgcgcggcgggcggtgggccgcgggggtgtccttggatgatgcatctaaaagcggtgacgcgggcgagcccccggaggtagggggggctccggacccgccgggagagggggcaggggcacgtcggcgccgcgcgcgggcaggagctggtgctgcgcgcgtaggttgctggcgaacgcgacgacgcggcggttgatctcctgaatctggcgcctctgcgtgaagacgacgggcccggtgagcttgagcctgaaagagagttcgacagaatcaatttcggtgtcgttgacggcggcctggcgcaaaatctcctgcacgtctcctgagttgtcttgataggcgatctcggccatgaactgctcgatctcttcctcctggagatctccgcgtccggctcgctccacggtggcggcgaggtcgttggaaatgcgggccatgagctgcgagaaggcgttgaggcctccctcgttccagacgcggctgtagaccacgcccccttcggcatcgcgggcgcgcatgaccacctgcgcgagattgagctccacgtgccgggcgaagacggcgtagtttcgcaggcgctgaaagaggtagttgagggtggtggcggtgtgttctgccacgaagaagtacataacccagcgtcgcaacgtggattcgttgatatcccccaaggcctcaaggcgctccatggcctcgtagaagtccacggcgaagttgaaaaactgggagttgcgcgccgacacggttaactcctcctccagaagacggatgagctcggcgacagtgtcgcgcacctcgcgctcaaaggctacaggggcctcttcttcttcttcaatctcctcttccataagggcctccccttcttcttcttctggcggcggtgggggaggggggacacggcggcgacgacggcgcaccgggaggcggtcgacaaagcgctcgatcatctccccgcggcgacggcgcatggtctcggtgacggcgcggccgttctcgcgggggcgcagttggaagacgccgcccgtcatgtcccggttatgggttggcggggggctgccatgcggcagggatacggcgctaacgatgcatctcaacaattgttgtgtaggtactccgccgccgagggacctgagcgagtccgcat 209|cgaccggatcggaaaacctctcgagaaaggcgtctaaccagtcacagtcgcaaggtaggctgagcaccgtggcgggcggcagcgggcggcggtcggggttgtttctggcggaggtgctgctgatgatgtaattaaagtaggcggtcttgagacggcggatggtcgacagaagcaccatgtccttgggtccggcctgctgaatgcgcaggcggtcggccatgccccaggcttcgttttgacatcggcgcaggtctttgtagtagtcttgcatgagcctttctaccggcacttcttcttctccttcctcttgtcctgcatctcttgcatctatcgctgcggcggcggcggagtttggccgtaggtggcgccctcttcctcccatgcgtgtgaccccgaagcccctcatcggctgaagcagggctaggtcggcgacaacgcgctcggctaatatggcctgctgcacctgcgtgagggtagactggaagtcatccatgtccacaaagcggtggtatgcgcccgtgttgatggtgtaagtgcagttggccataacggaccagttaacggtctggtgacccggctgcgagagctcggtgtacctgagacgcgagtaagccctcgagtcaaatacgtagtcgttgcaagtccgcaccaggtactggtatcccaccaaaaagtgcggcggcggctggcggtagaggggccagcgtagggtggccggggctccgggggcgagatcttccaacataaggcgatgatatccgtagatgtacctggacatccaggtgatgccggcggcggtggtggaggcgcgcggaaagtcgcggacgcggttccagatgttgcgcagcggcaaaaagtgctccatggtcgggacgctctggccggtcaggcgcgcgcaatcgttgacgctctagaccgtgcaaaaggagagcctgtaagcgggcactcttccgtggtctggtggataaattcgcaagggtatcatggcggacgaccggggttcgagccccgtatccggccgtccgccgtgatccatgcggttaccgcccgcgtgtcgaacccaggtgtgcgacgtcagacaacgggggagtgctccttttggcttccttccaggcgcggcggctgctgcgctagcttttttggccactggccgcgcgcagcgtaagcggttaggctggaaagcgaaagcattaagtggctcgctccctgtagccggagggttattttccaagggttgagtcgcgggacccccggttcgagtctcggaccggccggactgcggcgaacgggggtttgcctccccgtcatgcaagaccccgcttgcaaattcctccggaaacagggacgagccccttttttgcttttcccagatgcatccggtgctgcggcagatgcgcccc 209|cctcctcagcagcggcaagagcaagagcagcggcagacatgcagggcaccctcccctcctcctaccgcgtcaggaggggcgacatccgcggttgacgcggcagcagatggtgattacgaacccccgcggcgccgggcccggcactacctggacttggaggagggcgagggcctggcgcggctaggagcgccctctcctgagcggtacccaagggtgcagctgaagcgtgatacgcgtgaggcgtacgtgccgcggcagaacctgtttcgcgaccgcgagggagaggagcccgaggagatgcgggatcgaaagttccacgcagggcgcgagctgcggcatggcctgaatcgcgagcggttgctgcgcgaggaggactttgagcccgacgcgcgaaccgggattagtcccgcgcgcgcacacgtggcggccgccgacctggtaaccgcatacgagcagacggtgaaccaggagattaactttcaaaaaagctttaacaaccacgtgcgtacgcttgtggcgcgcgaggaggtggctataggactgatgcatctgtgggactttgtaagcgcgctggagcaaaacccaaatagcaagccgctcatggcgcagctgttccttatagtgcagcacagcagggacaacgaggcattcagggatgcgctgctaaacatagtagagcccgagggccgctggctgctcgatttgataaacatcctgcagagcatagtggtgcaggagcgcagcttgagcctggctgacaaggtggccgccatcaactattccatgcttagcctgggcaagttttacgcccgcaagatataccataccccttacgttcccatagacaaggaggtaaagatcgaggggttctacatgcgcatggcgctgaaggtgcttaccttgagcgacgacctgggcgtttatcgcaacgagcgcatccacaaggccgtgagcgtgagccggcggcgcgagctcagcgaccgcgagctgatgcacagcctgcaaagggccctggctggcacgggcagcggcgatagagaggccgagtcctactttgacgcgggcgctgacctgcgctgggccccaagccgacgcgccctggaggcagctggggccggacctgggctggcggtggcacccgcgcgcgctggcaacgtcggcggcgtggaggaatatgacgaggacgatgagtacgagccagaggacggcgagtactaagcggtgatgtttctgatcagatgatgcaagacgcaacggacccggcggtgcgggcggcgctgcagagccagccgtccggccttaactccacggacgactggcgccaggtcatggaccgcatcatgtcgctgactgcgcgcaatcctgacgcgttccggcagcagccgcaggccaaccggctc 209|tccgcaattctggaagcggtggtcccggcgcgcgcaaaccccacgcacgagaaggtgctggcgatcgtaaacgcgctggccgaaaacagggccatccggcccgacgaggccggcctggtctacgacgcgctgcttcagcgcgtggctcgttacaacagcggcaacgtgcagaccaacctggaccggctggtgggggatgtgcgcgaggccgtggcgcagcgtgagcgcgcgcagcagcagggcaacctgggctccatggttgcactaaacgccttcctgagtacacagcccgccaacgtgccgcggggacaggaggactacaccaactttgtgagcgcactgcggctaatggtgactgagacaccgcaaagtgaggtgtaccagtctgggccagactattttttccagaccagtagacaaggcctgcagaccgtaaacctgagccaggctttcaaaaacttgcaggggctgtggggggtgcgggctcccacaggcgaccgcgcgaccgtgtctagcttgctgacgcccaactcgcgcctgttgctgctgctaatagcgcccttcacggacagtggcagcgtgtcccgggacacatacctaggtcacttgctgacactgtaccgcgaggccataggtcaggcgcatgtggacgagcatactttccaggagattacaagtgtcagccgcgcgctggggcaggaggacacgggcagcctggaggcaaccctaaactacctgctgaccaaccggcggcagaagatcccctcgttgcacagtttaaacagcgaggaggagcgcattttgcgctacgtgcagcagagcgtgagccttaacctgatgcgcgacggggtaacgcccagcgtggcgctggacatgaccgcgcgcaacatggaaccgggcatgtatgcctcaaaccggccgtttatcaaccgcctaatggactacttgcatcgcgcggccgccgtgaaccccgagtatttcaccaatgccatcttgaacccgcactggctaccgccccctggtttctacaccgggggattcgaggtgcccgagggtaacgatggattcctctgggacgacatagacgacagcgtgttttccccgcaaccgcagaccctgctagagttgcaacagcgcgagcaggcagaggcggcgctgcgaaaggaaagcttccgcaggccaagcagcttgtccgatctaggcgctgcggccccgcggtcagatgctagtagcccatttccaagcttgatagggtctcttaccagcactcgcaccacccgcccgcgcctgctgggcgaggaggagtacctaaacaactcgctgctgcagccgcagcgcgaaaaaaacctgcctccggcatttcccaacaacgggatagagagcctagtggacaagatgag 209|tagatggaagacgtacgcgcaggagcacagggacgtgccaggcccgcgcccgcccacccgtcgtcaaaggcacgaccgtcagcggggtctggtgtgggaggacgatgactcggcagacgacagcagcgtcctggatttgggagggagtggcaacccgtttgcgcaccttcgccccaggctggggagaatgttttaaaaaaaaaaaagcatgatgcaaaataaaaaactcaccaaggccatggcaccgagcgttggttttcttgtattccccttagtatgcggcgcgcggcgatgtatgaggaaggtcctcctccctcctacgagagtgtggtgagcgcggcgccagtggcggcggcgctgggttctcccttcgatgctcccctggacccgccgtttgtgcctccgcggtacctgcggcctaccggggggagaaacagcatccgttactctgagttggcacccctattcgacaccacccgtgtgtacctggtggacaacaagtcaacggatgtggcatccctgaactaccagaacgaccacagcaactttctgaccacggtcattcaaaacaatgactacagcccgggggaggcaagcacacagaccatcaatcttgacgaccggtcgcactggggcggcgacctgaaaaccatcctgcataccaacatgccaaatgtgaacgagttcatgtttaccaataagtttaaggcgcgggtgatggtgtcgcgcttgcctactaaggacaatcaggtggagctgaaatacgagtgggtggagttcacgctgcccgagggcaactactccgagaccatgaccatagaccttatgaacaacgcgatcgtggagcactacttgaaagtgggcagacagaacggggttctggaaagcgacatcggggtaaagtttgacacccgcaacttcagactggggtttgaccccgtcactggtcttgtcatgcctggggtatatacaaacgaagccttccatccagacatcattttgctgccaggatgcggggtggacttcacccacagccgcctgagcaacttgttgggcatccgcaagcggcaacccttccaggagggctttaggatcacctacgatgatctggagggtggtaacattcccgcactgttggatgtggacgcctaccaggcgagcttgaaagatgacaccgaacagggcgggggtggcgcaggcggcagcaacagcagtggcagcggcgcggaagagaactccaacgcggcagccgcggcaatgcagccggtggaggacatgaacgatcatgccattcgcggcgacacctttgccacacgggctgaggagaagcgcgctgaggccgaagcagcggccgaagctgccgcccccgctgcgcaacccgaggtcgagaagcctcagaa 209|gaaaccggtgatcaaacccctgacagaggacagcaagaaacgcagttacaacctaataagcaatgacagcaccttcacccagtaccgcagctggtaccttgcatacaactacggcgaccctcagaccggaatccgctcatggaccctgctttgcactcctgacgtaacctgcggctcggagcaggtctactggtcgttgccagacatgatgcaagaccccgtgaccttccgctccacgcgccagatcagcaactttccggtggtgggcgccgagctgttgcccgtgcactccaagagcttctacaacgaccaggccgtctactcccaactcatccgccagtttacctctctgacccacgtgttcaatcgctttcccgagaaccagattttggcgcgcccgccagcccccaccatcaccaccgtcagtgaaaacgttcctgctctcacagatcacgggacgctaccgctgcgcaacagcatcggaggagtccagcgagtgaccattactgacgccagacgccgcacctgcccctacgtttacaaggccctgggcatagtctcgccgcgcgtcctatcgagccgcactttttgagcaagcatgtccatccttatatcgcccagcaataacacaggctggggcctgcgcttcccaagcaagatgtttggcggggccaagaagcgctccgaccaacacccagtgcgcgtgcgcgggcactaccgcgcgccctggggcgcgcacaaacgcggccgcactgggcgcaccaccgtcgatgacgccatcgacgcggtggtggaggaggcgcgcaactacacgcccacgccgccaccagtgtccacagtggacgcggccattcagaccgtggtgcgcggagcccggcgctatgctaaaatgaagagacggcggaggcgcgtagcacgtcgccaccgccgccgacccggcactgccgcccaacgcgcggcggcggccctgcttaaccgcgcacgtcgcaccggccgacgggcggccatgcgggccgctcgaaggctggccgcgggtattgtcactgtgccccccaggtccaggcgacgagcggccgccgcagcagccgcggccattagtgctatgactcagggtcgcaggggcaacgtgtattgggtgcgcgactcggttagcggcctgcgcgtgcccgtgcgcacccgccccccgcgcaactagattgcaagaaaaaactacttagactcgtactgttgtatgtatccagcggcggcggcgcgcaacgaagctatgtccaagcgcaaaatcaaagaagagatgctccaggtcatcgcgccggagatctatggccccccgaagaaggaagagcaggattacaagccccgaaagctaaagcgggtcaaaaagaaaaagaaagatgatgatg 209|atgaacttgacgacgaggtggaactgctgcacgctaccgcgcccaggcgacgggtacagtggaaaggtcgacgcgtaaaacgtgttttgcgacccggcaccaccgtagtctttacgcccggtgagcgctccacccgcacctacaagcgcgtgtatgatgaggtgtacggcgacgaggacctgcttgagcaggccaacgagcgcctcggggagtttgcctacggaaagcggcataaggacatgctggcgttgccgctggacgagggcaacccaacacctagcctaaagcccgtaacactgcagcaggtgctgcccgcgcttgcaccgtccgaagaaaagcgcggcctaaagcgcgagtctggtgacttggcacccaccgtgcagctgatggtacccaagcgccagcgactggaagatgtcttggaaaaaatgaccgtggaacctgggctggagcccgaggtccgcgtgcggccaatcaagcaggtggcgccgggactgggcgtgcagaccgtggacgttcagatacccactaccagtagcaccagtattgccaccgccacagagggcatggagacacaaacgtccccggttgcctcagcggtggcggatgccgcggtgcaggcggtcgctgcggccgcgtccaagacctctacggaggtgcaaacggacccgtggatgtttcgcgtttcagccccccggcgcccgcgcggttcgaggaagtacggcgccgccagcgcgctactgcccgaatatgccctacatccttccattgcgcctacccccggctatcgtggctacacctaccgccccagaagacgagcaactacccgacgccgaaccaccactggaacccgccgccgccgtcgccgtcgccagcccgtgctggccccgatttccgtgcgcagggtggctcgcgaaggaggcaggaccctggtgctgccaacagcgcgctaccaccccagcatcgtttaaaagccggtctttgtggttcttgcagatatggccctcacctgccgcctccgtttcccggtgccgggattccgaggaagaatgcaccgtaggaggggcatggccggccacggcctgacgggcggcatgcgtcgtgcgcaccaccggcggcggcgcgcgtcgcaccgtcgcatgcgcggcggtatcctgcccctccttattccactgatcgccgcggcgattggcgccgtgcccggaattgcatccgtggccttgcaggcgcagagacactgattaaaaacaagttgcatgtggaaaaatcaaaataaaaagtctggactctcacgctcgcttggtcctgtaactattttgtagaatggaagacatcaactttgcgtctctggccccgcgacacggctcgcgcccgttcatgggaaactggcaagatatcgg 209|caccagcaatatgagcggtggcgccttcagctggggctcgctgtggagcggcattaaaaatttcggttccaccgttaagaactatggcagcaaggcctggaacagcagcacaggccagatgctgagggataagttgaaagagcaaaatttccaacaaaaggtggtagatggcctggcctctggcattagcggggtggtggacctggccaaccaggcagtgcaaaataagattaacagtaagcttgatccccgccctcccgtagaggagcctccaccggccgtggagacagtgtctccagaggggcgtggcgaaaagcgtccgcgccccgacagggaagaaactctggtgacgcaaatagacgagcctccctcgtacgaggaggcactaaagcaaggcctgcccaccacccgtcccatcgcgcccatggctaccggagtgctgggccagcacacacccgtaacgctggacctgcctccccccgccgacacccagcagaaacctgtgctgccaggcccgaccgccgttgttgtaacccgtcctagccgcgcgtccctgcgccgcgccgccagcggtccgcgatcgttgcggcccgtagccagtggcaactggcaaagcacactgaacagcatcgtgggtctgggggtgcaatccctgaagcgccgacgatgcttctgaatagctaacgtgtcgtatgtgtgtcatgtatgcgtccatgtcgccgccagaggagctgctgagccgccgcgcgcccgctttccaagatggctaccccttcgatgatgccgcagtggtcttacatgcacatctcgggccaggacgcctcggagtacctgagccccgggctggtgcagtttgcccgcgccaccgagacgtacttcagcctgaataacaagtttagaaaccccacggtggcgcctacgcacgacgtgaccacagaccggtcccagcgtttgacgctgcggttcatccctgtggaccgtgaggatactgcgtactcgtacaaggcgcggttcaccctagctgtgggtgataaccgtgtgctggacatggcttccacgtactttgacatccgcggcgtgctggacaggggccctacttttaagccctactctggcactgcctacaacgccctggctcccaagggtgccccaaatccttgcgaatgggatgaagctgctactgctcttgaaataaacctagaagaagaggacgatgacaacgaagacgaagtagacgagcaagctgagcagcaaaaaactcacgtatttgggcaggcgccttattctggtataaatattacaaaggagggtattcaaataggtgtcgaaggtcaaacacctaaatatgccgataaaacatttcaacctgaacctcaaataggagaatctcagtggtacga 209|aactgaaattaatcatgcagctgggagagtccttaaaaagactaccccaatgaaaccatgttacggttcatatgcaaaacccacaaatgaaaatggagggcaaggcattcttgtaaagcaacaaaatggaaagctagaaagtcaagtggaaatgcaatttttctcaactactgaggcgaccgcaggcaatggtgataacttgactcctaaagtggtattgtacagtgaagatgtagatatagaaaccccagacactcatatttcttacatgcccactattaaggaaggtaactcacgagaactaatgggccaacaatctatgcccaacaggcctaattacattgcttttagggacaattttattggtctaatgtattacaacagcacgggtaatatgggtgttctggcgggccaagcatcgcagttgaatgctgttgtagatttgcaagacagaaacacagagctttcataccagcttttgcttgattccattggtgatagaaccaggtacttttctatgtggaatcaggctgttgacagctatgatccagatgttagaattattgaaaatcatggaactgaagatgaacttccaaattactgctttccactgggaggtgtgattaatacagagactcttaccaaggtaaaacctaaaacaggtcaggaaaatggatgggaaaaagatgctacagaattttcagataaaaatgaaataagagttggaaataattttgccatggaaatcaatctaaatgccaacctgtggagaaatttcctgtactccaacatagcgctgtatttgcccgacaagctaaagtacagtccttccaacgtaaaaatttctgataacccaaacacctacgactacatgaacaagcgagtggtggctcccgggttagtggactgctacattaaccttggagcacgctggtcccttgactatatggacaacgtcaacccatttaaccaccaccgcaatgctggcctgcgctaccgctcaatgttgctgggcaatggtcgctatgtgcccttccacatccaggtgcctcagaagttctttgccattaaaaacctccttctcctgccgggctcatacacctacgagtggaacttcaggaaggatgttaacatggttctgcagagctccctaggaaatgacctaagggttgacggagccagcattaagtttgatagcatttgcctttacgccaccttcttccccatggcccacaacaccgcctccacgcttgaggccatgcttagaaacgacaccaacgaccagtcctttaacgactatctctccgccgccaacatgctctaccctatacccgccaacgctaccaacgtgcccatatccatcccctcccgcaactgggcggctttccgcggctgggcct 209|tcacgcgccttaagactaaggaaaccccatcactgggctcgggctacgacccttattacacctactctggctctataccctacctagatggaaccttttacctcaaccacacctttaagaaggtggccattacctttgactcttctgtcagctggcctggcaatgaccgcctgcttacccccaacgagtttgaaattaagcgctcagttgacggggagggttacaacgttgcccagtgtaacatgaccaaagactggttcctggtacaaatgctagctaactacaacattggctaccagggcttctatatcccagagagctacaaggaccgcatgtactccttctttagaaacttccagcccatgagccgtcaggtggtggatgatactaaatacaaggactaccaacaggtgggcatcctacaccaacacaacaactctggatttgttggctaccttgcccccaccatgcgcgaaggacaggcctaccctgctaacttcccctatccgcttataggcaagaccgcagttgacagcattacccagaaaaagtttctttgcgatcgcaccctttggcgcatcccattctccagtaactttatgtccatgggcgcactcacagacctgggccaaaaccttctctacgccaactccgcccacgcgctagacatgacttttgaggtggatcccatggacgagcccacccttctttatgttttgtttgaagtctttgacgtggtccgtgtgcaccggccgcaccgcggcgtcatcgaaaccgtgtacctgcgcacgcccttctcggccggcaacgccacaacataaagaagcaagcaacatcaacaacagctgccgccatgggctccagtgagcaggaactgaaagccattgtcaaagatcttggttgtgggccatattttttgggcacctatgacaagcgctttccaggctttgtttctccacacaagctcgcctgcgccatagtcaatacggccggtcgcgagactgggggcgtacactggatggcctttgcctggaacccgcactcaaaaacatgctacctctttgagccctttggcttttctgaccagcgactcaagcaggtttaccagtttgagtacgagtcactcctgcgccgtagcgccattgcttcttcccccgaccgctgtataacgctggaaaagtccacccaaagcgtacaggggcccaactcggccgcctgtggactattctgctgcatgtttctccacgcctttgccaactggccccaaactcccatggatcacaaccccaccatgaaccttattaccggggtacccaactccatgctcaacagtccccaggtacagcccaccctgcgtcgcaaccaggaacagctctacagcttcctggagcgccactcgc 209|cctacttccgcagccacagtgcgcagattaggagcgccacttctttttgtcacttgaaaaacatgtaaaaataatgtactagagacactttcaataaaggcaaatgcttttatttgtacactctcgggtgattatttacccccacccttgccgtctgcgccgtttaaaaatcaaaggggttctgccgcgcatcgctatgcgccactggcagggacacgttgcgatactggtgtttagtgctccacttaaactcaggcacaaccatccgcggcagctcggtgaagttttcactccacaggctgcgcaccatcaccaacgcgtttagcaggtcgggcgccgatatcttgaagtcgcagttggggcctccgccctgcgcgcgcgagttgcgatacacagggttgcagcactggaacactatcagcgccgggtggtgcacgctggccagcacgctcttgtcggagatcagatccgcgtccaggtcctccgcgttgctcagggcgaacggagtcaactttggtagctgccttcccaaaaagggcgcgtgcccaggctttgagttgcactcgcaccgtagtggcatcaaaaggtgaccgtgcccggtctgggcgttaggatacagcgcctgcataaaagccttgatctgcttaaaagccacctgagcctttgcgccttcagagaagaacatgccgcaagacttgccggaaaactgattggccggacaggccgcgtcgtgcacgcagcaccttgcgtcggtgttggagatctgcaccacatttcggccccaccggttcttcacgatcttggccttgctagactgctccttcagcgcgcgctgcccgttttcgctcgtcacatccatttcaatcacgtgctccttatttatcataatgcttccgtgtagacacttaagctcgccttcgatctcagcgcagcggtgcagccacaacgcgcagcccgtgggctcgtgatgcttgtaggtcacctctgcaaacgactgcaggtacgcctgcaggaatcgccccatcatcgtcacaaaggtcttgttgctggtgaaggtcagctgcaacccgcggtgctcctcgttcagccaggtcttgcatacggccgccagagcttccacttggtcaggcagtagtttgaagttcgcctttagatcgttatccacgtggtacttgtccatcagcgcgcgcgcagcctccatgcccttctcccacgcagacacgatcggcacactcagcgggttcatcaccgtaatttcactttccgcttcgctgggctcttcctcttcctcttgcgtccgcataccacgcgccactgggtcgtcttcattcagccgccgcactgtgcgcttacctcctttgccatgcttgattagcaccggtgggttgctgaaacccacc 209|atttgtagcgccacatcttctctttcttcctcgctgtccacgattacctctggtgatggcgggcgctcgggcttgggagaagggcgcttctttttcttcttgggcgcaatggccaaatccgccgccgaggtcgatggccgcgggctgggtgtgcgcggcaccagcgcgtcttgtgatgagtcttcctcgtcctcggactcgatacgccgcctcatccgcttttttgggggcgcccggggaggcggcggcgacggggacggggacgacacgtcctccatggttgggggacgtcgcgccgcaccgcgtccgcgctcgggggtggtttcgcgctgctcctcttcccgactggccatttccttctcctataggcagaaaaagatcatggagtcagtcgagaagaaggacagcctaaccgccccctctgagttcgccaccaccgcctccaccgatgccgccaacgcgcctaccaccttccccgtcgaggcacccccgcttgaggaggaggaagtgattatcgagcaggacccaggttttgtaagcgaagacgacgaggaccgctcagtaccaacagaggataaaaagcaagaccaggacaacgcagaggcaaacgaggaacaagtcgggcggggggacgaaaggcatggcgactacctagatgtgggagacgacgtgctgttgaagcatctgcagcgccagtgcgccattatctgcgacgcgttgcaagagcgcagcgatgtgcccctcgccatagcggatgtcagccttgcctacgaacgccacctattctcaccgcgcgtaccccccaaacgccaagaaaacggcacatgcgagcccaacccgcgcctcaacttctaccccgtatttgccgtgccagaggtgcttgccacctatcacatctttttccaaaactgcaagatacccctatcctgccgtgccaaccgcagccgagcggacaagcagctggccttgcggcagggcgctgtcatacctgatatcgcctcgctcaacgaagtgccaaaaatctttgagggtcttggacgcgacgagaagcgcgcggcaaacgctctgcaacaggaaaacagcgaaaatgaaagtcactctggagtgttggtggaactcgagggtgacaacgcgcgcctagccgtactaaaacgcagcatcgaggtcacccactttgcctacccggcacttaacctaccccccaaggtcatgagcacagtcatgagtgagctgatcgtgcgccgtgcgcagcccctggagagggatgcaaatttgcaagaacaaacagaggagggcctacccgcagttggcgacgagcagctagcgcgctggcttcaaacgcgcgagcctgccgacttggaggagcgacgcaaactaatgatggccgcagtgctcgttac 209|cgtggagcttgagtgcatgcagcggttctttgctgacccggagatgcagcgcaagctagaggaaacattgcactacacctttcgacagggctacgtacgccaggcctgcaagatctccaacgtggagctctgcaacctggtctcctaccttggaattttgcacgaaaaccgccttgggcaaaacgtgcttcattccacgctcaagggcgaggcgcgccgcgactacgtccgcgactgcgtttacttatttctatgctacacctggcagacggccatgggcgtttggcagcagtgcttggaggagtgcaacctcaaggagctgcagaaactgctaaagcaaaacttgaaggacctatggacggccttcaacgagcgctccgtggccgcgcacctggcggacatcattttccccgaacgcctgcttaaaaccctgcaacagggtctgccagacttcaccagtcaaagcatgttgcagaactttaggaactttatcctagagcgctcaggaatcttgcccgccacctgctgtgcacttcctagcgactttgtgcccattaagtaccgcgaatgccctccgccgctttggggccactgctaccttctgcagctagccaactaccttgcctaccactctgacataatggaagacgtgagcggtgacggtctactggagtgtcactgtcgctgcaacctatgcaccccgcaccgctccctggtttgcaattcgcagctgcttaacgaaagtcaaattatcggtacctttgagctgcagggtccctcgcctgacgaaaagtccgcggctccggggttgaaactcactccggggctgtggacgtcggcttaccttcgcaaatttgtacctgaggactaccacgcccacgagattaggttctacgaagaccaatcccgcccgccaaatgcggagcttaccgcctgcgtcattacccagggccacattcttggccaattgcaagccatcaacaaagcccgccaagagtttctgctacgaaagggacggggggtttacttggacccccagtccggcgaggagctcaacccaatccccccgccgccgcagccctatcagcagcagccgcgggcccttgcttcccaggatggcacccaaaaagaagctgcagctgccgccgccacccacggacgaggaggaatactgggacagtcaggcagaggaggttttggacgaggaggaggaggacatgatggaagactgggagagcctagacgaggaagcttccgaggtcgaagaggtgtcagacgaaacaccgtcaccctcggtcgcattcccctcgccggcgccccagaaatcggcaaccggttccagcatggctacaacctccgctcctcaggcgccgccggcactgcccgttcgccgacccaac 209|cgtagatgggacaccactggaaccagggccggtaagtccaagcagccgccgccgttagcccaagagcaacaacagcgccaaggctaccgctcatggcgcgggcacaagaacgccatagttgcttgcttgcaagactgtgggggcaacatctccttcgcccgccgctttcttctctaccatcacggcgtggccttcccccgtaacatcctgcattactaccgtcatctctacagcccatactgcaccggcggcagcggcagcggcagcaacagcagcggccacacagaagcaaaggcgaccggatagcaagactctgacaaagcccaagaaatccacagcggcggcagcagcaggaggaggagcgctgcgtctggcgcccaacgaacccgtatcgacccgcgagcttagaaacaggatttttcccactctgtatgctatatttcaacagagcaggggccaagaacaagagctgaaaataaaaaacaggtctctgcgatccctcacccgcagctgcctgtatcacaaaagcgaagatcagcttcggcgcacgctggaagacgcggaggctctcttcagtaaatactgcgcgctgactcttaaggactagtttcgcgccctttctcaaatttaagcgcgaaaactacgtcatctccagcggccacacccggcgccagcacctgtcgtcagcgccattatgagcaaggaaattcccacgccctacatgtggagttaccagccacaaatgggacttgcggctggagctgcccaagactactcaacccgaataaactacatgagcgcgggaccccacatgatatcccgggtcaacggaatccgcgcccaccgaaaccgaattctcttggaacaggcggctattaccaccacacctcgtaataaccttaatccccgtagttggcccgctgccctggtgtaccaggaaagtcccgctcccaccactgtggtacttcccagagacgcccaggccgaagttcagatgactaactcaggggcgcagcttgcgggcggctttcgtcacagggtgcggtcgcccgggcagggtataactcacctgacaatcagagggcgaggtattcagctcaacgacgagtcggtgagctcctcgcttggtctccgtccggacgggacatttcagatcggcggcgccggccgtccttcattcacgcctcgtcaggcaatcctaactctgcagacctcgtcctctgagccgcgctctggaggcattggaactctgcaatttattgaggagtttgtgccatcggtctactttaaccccttctcgggacctcccggccactatccggatcaatttattcctaactttgacgcggtaaaggactcggcggacggctacgactgaatgttaagtggagaggcagagc 209|aactgcgcctgaaacacctggtccactgtcgccgccacaagtgctttgcccgcgactccggtgagttttgctactttgaattgcccgaggatcatatcgagggcccggcgcacggcgtccggcttaccgcccagggagagcttgcccgtagcctgattcgggagtttacccagcgccccctgctagttgagcgggacaggggaccctgtgttctcactgtgatttgcaactgtcctaaccttggattacatcaagatctttgttgccatctctgtgctgagtataataaatacagaaattaaaatatactggggctcctatcgccatcctgtaaacgccaccgtcttcacccgcccaagcaaaccaaggcgaaccttacctggtacttttaacatctctccctctgtgatttacaacagtttcaacccagacggagtgagtctacgagagaacctctccgagctcagctactccatcagaaaaaacaccaccctccttacctgccgggaacgtacgagtgcgtcaccggccgctgcaccacacctaccgcctgaccgtaaaccagactttttccggacagacctcaataactctgtttaccagaacaggaggtgagcttagaaaacccttagggtattaggccaaaggcgcagctactgtggggtttatgaacaattcaagcaactctacgggctattctaattcaggtttctctagaaatggacggaattattacagagcagcgcctgctagaaagacgcagggcagcggccgagcaacagcgcatgaatcaagagctccaagacatggttaacttgcaccagtgcaaaaggggtatcttttgtctggtaaagcaggccaaagtcacctacgacagtaataccaccggacaccgccttagctacaagttgccaaccaagcgtcagaaattggtggtcatggtgggagaaaagcccattaccataactcagcactcggtagaaaccgaaggctgcattcactcaccttgtcaaggacctgaggatctctgcacccttattaagaccctgtgcggtctcaaagatcttattccctttaactaataaaaaaaaataataaagcatcacttacttaaaatcagttagcaaatttctgtccagtttattcagcagcacctccttgccctcctcccagctctggtattgcagcttcctcctggctgcaaactttctccacaatctaaatggaatgtcagtttcctcctgttcctgtccatccgcacccactatcttcatgttgttgcagatgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtt 209|tcaagagagtccccctggggtactctctttgcgcctatccgaacctctagttacctccaatggcatgcttgcgctcaaaatgggcaacggcctctctctggacgaggccggcaaccttacctcccaaaatgtaaccactgtgagcccacctctcaaaaaaaccaagtcaaacataaacctggaaatatctgcacccctcacagttacctcagaagccctaactgtggctgccgccgcacctctaatggtcgcgggcaacacactcaccatgcaatcacaggccccgctaaccgtgcacgactccaaacttagcattgccacccaaggacccctcacagtgtcagaaggaaagctagccctgcaaacatcaggccccctcaccaccaccgatagcagtacccttactatcactgcctcaccccctctaactactgccactggtagcttgggcattgacttgaaagagcccatttatacacaaaatggaaaactaggactaaagtacggggctcctttgcatgtaacagacgacctaaacactttgaccgtagcaactggtccaggtgtgactattaataatacttccttgcaaactaaagttactggagccttgggttttgattcacaaggcaatatgcaacttaatgtagcaggaggactaaggattgattctcaaaacagacgccttatacttgatgttagttatccgtttgatgctcaaaaccaactaaatctaagactaggacagggccctctttttataaactcagcccacaacttggatattaactacaacaaaggcctttacttgtttacagcttcaaacaattccaaaaagcttgaggttaacctaagcactgccaaggggttgatgtttgacgctacagccatagccattaatgcaggagatgggcttgaatttggttcacctaatgcaccaaacacaaatcccctcaaaacaaaaattggccatggcctagaatttgattcaaacaaggctatggttcctaaactaggaactggccttagttttgacagcacaggtgccattacagtaggaaacaaaaataatgataagctaactttgtggaccacaccagctccatctcctaactgtagactaaatgcagagaaagatgctaaactcactttggtcttaacaaaatgtggcagtcaaatacttgctacagtttcagttttggctgttaaaggcagtttggctccaatatctggaacagttcaaagtgctcatcttattataagatttgacgaaaatggagtgctactaaacaattccttcctggacccagaatattggaactttagaaatggagatcttactgaaggcacagcctatacaaacgctgttggatttatgcctaacctatcagcttatccaa 209|aatctcacggtaaaactgccaaaagtaacattgtcagtcaagtttacttaaacggagacaaaactaaacctgtaacactaaccattacactaaacggtacacaggaaacaggagacacaactccaagtgcatactctatgtcattttcatgggactggtctggccacaactacattaatgaaatatttgccacatcctcttacactttttcatacattgcccaagaataaagaatcgtttgtgttatgtttcaacgtgtttatttttcaattgcagaaaatttcgaatcatttttcattcagtagtatagccccaccaccacatagcttatacagatcaccgtaccttaatcaaactcacagaaccctagtattcaacctgccacctccctcccaacacacagagtacacagtcctttctccccggctggccttaaaaagcatcatatcatgggtaacagacatattcttaggtgttatattccacacggtttcctgtcgagccaaacgctcatcagtgatattaataaactccccgggcagctcacttaagttcatgtcgctgtccagctgctgagccacaggctgctgtccaacttgcggttgcttaacgggcggcgaaggagaagtccacgcctacatgggggtagagtcataatcgtgcatcaggatagggcggtggtgctgcagcagcgcgcgaataaactgctgccgccgccgctccgtcctgcaggaatacaacatggcagtggtctcctcagcgatgattcgcaccgcccgcagcataaggcgccttgtcctccgggcacagcagcgcaccctgatctcacttaaatcagcacagtaactgcagcacagcaccacaatattgttcaaaatcccacagtgcaaggcgctgtatccaaagctcatggcggggaccacagaacccacgtggccatcataccacaagcgcaggtagattaagtggcgacccctcataaacacgctggacataaacattacctcttttggcatgttgtaattcaccacctcccggtaccatataaacctctgattaaacatggcgccatccaccaccatcctaaaccagctggccaaaacctgcccgccggctatacactgcagggaaccgggactggaacaatgacagtggagagcccaggactcgtaaccatggatcatcatgctcgtcatgatatcaatgttggcacaacacaggcacacgtgcatacacttcctcaggattacaagctcctcccgcgttagaaccatatcccagggaacaacccattcctgaatcagcgtaaatcccacactgcagggaagacctcgcacgtaactcacgttgtgcattgtcaaagtgttacattcgggcagcagcggatgatcctccagtat 209|ggtagcgcgggtttctgtctcaaaaggaggtagacgatccctactgtacggagtgcgccgagacaaccgagatcgtgttggtcgtagtgtcatgccaaatggaacgccggacgtagtcatatttcctgaagcaaaaccaggtgcgggcgtgacaaacagatctgcgtctccggtctcgccgcttagatcgctctgtgtagtagttgtagtatatccactctctcaaagcatccaggcgccccctggcttcgggttctatgtaaactccttcatgcgccgctgccctgataacatccaccaccgcagaataagccacacccagccaacctacacattcgttctgcgagtcacacacgggaggagcgggaagagctggaagaaccatgtttttttttttattccaaaagattatccaaaacctcaaaatgaagatctattaagtgaacgcgctcccctccggtggcgtggtcaaactctacagccaaagaacagataatggcatttgtaagatgttgcacaatggcttccaaaaggcaaacggccctcacgtccaagtggacgtaaaggctaaacccttcagggtgaatctcctctataaacattccagcaccttcaaccatgcccaaataattctcatctcgccaccttctcaatatatctctaagcaaatcccgaatattaagtccggccattgtaaaaatctgctccagagcgccctccaccttcagcctcaagcagcgaatcatgattgcaaaaattcaggttcctcacagacctgtataagattcaaaagcggaacattaacaaaaataccgcgatcccgtaggtcccttcgcagggccagctgaacataatcgtgcaggtctgcacggaccagcgcggccacttccccgccaggaaccttgacaaaagaacccacactgattatgacacgcatactcggagctatgctaaccagcgtagccccgatgtaagctttgttgcatgggcggcgatataaaatgcaaggtgctgctcaaaaaatcaggcaaagcctcgcgcaaaaaagaaagcacatcgtagtcatgctcatgcagataaaggcaggtaagctccggaaccaccacagaaaaagacaccatttttctctcaaacatgtctgcgggtttctgcataaacacaaaataaaataacaaaaaaacatttaaacattagaagcctgtcttacaacaggaaaaacaacccttataagcataagacggactacggccatgccggcgtgaccgtaaaaaaactggtcaccgtgattaaaaagcaccaccgacagctcctcggtcatgtccggagtcataatgtaagactcggtaaacacatcaggttgattcacatcggtcagtgctaaaaagcgaccgaaatagccc 209|gggggaatacatacccgcaggcgtagagacaacattacagcccccataggaggtataacaaaattaataggagagaaaaacacataaacacctgaaaaaccctcctgcctaggcaaaatagcaccctcccgctccagaacaacatacagcgcttccacagcggcagccataacagtcagccttaccagtaaaaaagaaaacctattaaaaaaacaccactcgacacggcaccagctcaatcagtcacagtgtaaaaaagggccaagtgcagagcgagtatatataggactaaaaaatgacgtaacggttaaagtccacaaaaaacacccagaaaaccgcacgcgaacctacgcccagaaacgaaagccaaaaaacccacaacttcctcaaatcgtcacttccgttttcccacgttacgtcacttcccattttaagaaaactacaattcccaacacatacaagttactccgccctaaaacctacgtcacccgccccgttcccacgccccgcgccacgtcacaaactccaccccctcattatcatattggcttcaatccaaaataaggtatattattgatgatgttaattaatttaaatccgcatgcgatatcgagctctcccgggaattcggatctgcgacgcgaggctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggtagatgacgaccatcagggacagcttcacggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagat 209|cctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgntgcaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaacacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtcttcaaggatccgaattcccgggagagctcgatatcgcatgcggatttaaattaattaa 210 212 25|pBAD-DEST49 278|GenBank 27|0 222|1 33|6160 236|38836800 237|326807313 26|874 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 629 53|0 55|1 56|6160 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="629" 50 45 51|4 52|6xHis 53|0 55|2487 56|2504 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1010000" 50 45 51|4 52|Amp(R) 53|0 55|3047 56|3907 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|30 52|araBAD promoter and regulatory elements 53|0 55|4 56|276 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2320000" 50 45 51|4 52|AraC 53|1 55|5256 56|6134 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1030000" 50 45 51|86 52|attR1 53|0 55|718 56|842 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2298 56|2422 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|2948 56|3046 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1952 56|2257 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|951 56|1610 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|EK recognition site 53|0 55|691 56|705 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1100000" 50 45 51|27 52|pBAD forward primer 53|0 55|208 56|227 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2040000" 50 45 51|27 52|pBAD reverse primer 53|1 55|2560 56|2577 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2050000" 50 45 51|33 52|pUC origin 53|0 55|4052 56|4725 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 and T2 transcription terminator 53|0 55|2610 56|2767 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2570000" 50 45 51|4 52|His-Patch Thioredoxin (no stop) 53|0 55|346 56|675 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1310000" 50 45 51|27 52|TrxFus forward primer 53|0 55|655 56|672 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2130000" 50 45 51|27 52|V5 reverse primer 53|1 55|2445 56|2465 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|2436 56|2477 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|32 52|RBS 53|0 55|329 56|332 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000003" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|aagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttgggctagaaataattttgtttaactttaagaaggagatatacatacccatgggatctgataaaattattcatctgactgatgattcttttgatactgatgtacttaaggcagatggtgcaatcctggttgatttctgggcacactggtgcggtccgtgcaaaatgatcgctccgattctggatgaaatcgctgacgaatatcagggcaaactgaccgttgcaaaactgaacatcgatcacaacccgggcactgcgccgaaatatggcatccgtggtatcccgactctgctgctgttcaaaaacggtgaagtggcggcaaccaaagtgggtgcactgtctaaaggtcagttgaaagagttcctcgacgctaacctggccggctctggatccggtgatgacgatgacaagctgggaattatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgg 209|gtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgatcaagcttgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacggtctccagcttggctgttttggcggatgagagaagattttcagcctgatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctct 209|cctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaattaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactctttttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcag 209|cagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagcagatcaattcgcgcgcgaaggcgaagcggcatgcataatgtgcctgtcaaatggacgaagcagggattctgcaaaccctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtac 209|ccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagag 210 212 25|pcDNA-DEST40 278|GenBank 27|0 222|1 33|7143 236|38836800 237|326807313 26|877 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria|Animal/Other Eukaryotic 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|7143 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="625" 50 45 51|4 52|6xHis 53|0 55|2692 56|2709 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1010000" 50 45 51|4 52|Amp(R) 53|1 55|6147 56|7007 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|911 56|1035 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2491 56|2615 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|26 52|BGH pA 53|0 55|2738 56|2962 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1870000" 50 45 51|27 52|BGH reverse primer 53|1 55|2732 56|2749 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1910000" 50 45 51|30 52|bla promoter 53|1 55|7008 56|7106 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|2145 56|2450 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|1144 56|1803 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|CMV forward primer 53|0 55|769 56|789 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|232 56|819 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2180000" 50 45 51|33 52|f1 origin 53|0 55|3008 56|3436 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Neo(R) 53|0 55|3846 56|4640 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1260000" 50 45 51|33 52|pUC origin 53|1 55|5329 56|6002 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|29 52|SV40 early promoter 53|0 55|3441 56|3810 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|25 52|SV40 pA 53|0 55|4816 56|4946 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|27 52|T7 primer 53|0 55|863 56|882 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|863 56|879 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|27 52|V5 reverse primer 53|1 55|2650 56|2670 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|2641 56|2682 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaagctatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatggga 209|tagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctgg 209|aaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatg 209|caatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggta 209|tctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaa 209|tactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc 210 212 25|pcDNA-DEST47 278|GenBank 27|0 222|1 33|7952 236|38836800 237|326807313 26|878 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria|Animal/Other Eukaryotic 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|7952 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="626" 50 45 51|4 52|Amp(R) 53|1 55|6956 56|7816 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|917 56|1041 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2665 56|2789 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|26 52|BGH pA 53|0 55|3547 56|3771 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1870000" 50 45 51|30 52|bla promoter 53|1 55|7817 56|7915 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|2319 56|2624 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|1318 56|1977 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|CMV forward primer 53|0 55|769 56|789 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|232 56|819 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2180000" 50 45 51|33 52|f1 origin 53|0 55|3817 56|4245 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Cycle 3 GFP 53|0 55|2800 56|3519 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1130000" 50 45 51|27 52|GFP reverse primer 53|1 55|2911 56|2932 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1970000" 50 45 51|4 52|Neo(R) 53|0 55|4655 56|5449 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1260000" 50 45 51|33 52|pUC origin 53|1 55|6138 56|6811 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|29 52|SV40 early promoter 53|0 55|4250 56|4619 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|25 52|SV40 pA 53|0 55|5625 56|5755 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|27 52|T7 primer 53|0 55|863 56|882 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|863 56|879 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaagcttggtactcaaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcgggtgatgctgccaacttagcggccgctaagttggcagcatcacccgacgcactttgcgccgaataaatacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagt 209|tgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatctagaggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttcgatctagaa 209|tggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataatgaattaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcct 209|attggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctc 209|atgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtct 209|atttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc 210 212 25|pcDNA-DEST53 278|GenBank 27|0 222|1 33|7767 236|38836800 237|326807313 26|879 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria|Animal/Other Eukaryotic 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|7767 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="628" 50 45 51|4 52|Amp(R) 53|1 55|6771 56|7631 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|1643 56|1767 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|3202 56|3326 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|26 52|BGH pA 53|0 55|3364 56|3588 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1870000" 50 45 51|27 52|BGH reverse primer 53|1 55|3358 56|3375 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1910000" 50 45 51|30 52|bla promoter 53|1 55|7632 56|7730 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|2856 56|3161 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|1876 56|2535 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|29 52|CMV promoter 53|0 55|232 56|819 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2180000" 50 45 51|33 52|f1 origin 53|0 55|3634 56|4062 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|cycle 3 GFP (no stop) 53|0 55|905 56|1621 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1140000" 50 45 51|27 52|GFP forward primer 53|0 55|1512 56|1531 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1960000" 50 45 51|4 52|Neo(R) 53|0 55|4472 56|5266 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1260000" 50 45 51|33 52|pUC origin 53|1 55|5953 56|6626 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|29 52|SV40 early promoter 53|0 55|4067 56|4436 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|25 52|SV40 pA 53|0 55|5440 56|5570 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|30 52|T7 promoter 53|0 55|863 56|879 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagacaccatggccagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaact 209|tcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaaagcggttggcctccggatcaaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctcgcgaaccggtgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtc 209|gcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgataattaattaagataaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtat 209|gcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggc 209|gtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccg 209|cctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc 210 212 25|pcDNA3.1/nV5-DEST 278|GenBank 27|0 222|1 33|7136 236|38836800 237|326807314 26|893 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|7136 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="698" 50 45 51|4 52|Amp(R) 53|1 55|6140 56|7000 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|1007 56|1131 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2587 56|2711 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|26 52|BGH pA 53|0 55|2736 56|2960 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1870000" 50 45 51|27 52|BGH reverse primer 53|1 55|2730 56|2747 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1910000" 50 45 51|30 52|bla promoter 53|1 55|7001 56|7099 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|2241 56|2546 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|1240 56|1899 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|CMV forward primer 53|0 55|769 56|789 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|232 56|819 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2180000" 50 45 51|33 52|f1 origin 53|0 55|3006 56|3434 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Neo(R) 53|0 55|3844 56|4638 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1260000" 50 45 51|33 52|pUC origin 53|1 55|5325 56|5995 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|29 52|SV40 early promoter 53|0 55|3439 56|3808 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|25 52|SV40 pA 53|0 55|4812 56|4942 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|27 52|T7 primer 53|0 55|863 56|882 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|863 56|879 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|4 52|TEV recognition site 53|0 55|956 56|976 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1300000" 50 45 51|4 52|V5 epitope 53|0 55|914 56|955 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaagcttaccatgggtaagcctatccctaaccctctcctcggtctcgattctacggaaaacctgtattttcagggcccggatccgtcgacgaattctgcagatatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaa 209|gttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgataaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaa 209|ggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgca 209|atgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctc 209|agttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcat 209|actcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc 210 212 25|pcDNA3.2/V5-DEST 278|GenBank 27|0 222|1 33|7711 236|38836800 237|326807314 26|900 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|7711 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="699" 50 45 51|4 52|Amp(R) 53|1 55|6715 56|7575 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|911 56|1035 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|3051 56|3175 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|1 55|7576 56|7674 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|1 55|1464 56|1769 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|1 55|2111 56|2770 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|CMV forward primer 53|0 55|769 56|789 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|232 56|819 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2180000" 50 45 51|33 52|f1 origin 53|0 55|3576 56|4004 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Neo(R) 53|0 55|4414 56|5208 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1260000" 50 45 51|33 52|pUC origin 53|1 55|5897 56|6570 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|29 52|SV40 early promoter 53|0 55|4009 56|4378 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|25 52|SV40 pA 53|0 55|5384 56|5514 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|27 52|T7 primer 53|0 55|863 56|882 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|863 56|879 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|25 52|TK pA 53|0 55|3269 56|3540 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1860000" 50 45 51|27 52|TK pA reverse primer 53|1 55|3276 56|3294 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2120000" 50 45 51|27 52|V5 reverse primer 53|1 55|3210 56|3230 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|3201 56|3242 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|4 52|3 stops 53|0 55|3252 56|3260 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000001" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaagctatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgat 209|aaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagtccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcacacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcga 209|taactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggttagtaatgagtttaaacgggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacgggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagaccccattggggccaatacgcccgcgtttcttccttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagcagatctgcgcagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatc 209|ccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccac 209|acaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagtt 209|aatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc 210 212 25|pcDNA3.2/V5-GW/D-TOPO 278|GenBank 27|1 222|1 33|5532 236|38836800 237|326807314 26|901 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|5532 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="739" 50 45 51|4 52|Amp(R) 53|1 55|3581 56|4441 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attB1 53|0 55|5488 56|5512 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2650000" 50 45 51|86 52|attB2 53|1 55|17 56|41 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2660000" 50 45 51|30 52|bla promoter 53|1 55|4442 56|4540 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|27 52|CMV forward primer 53|0 55|5346 56|5366 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|4809 56|5396 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2180000" 50 45 51|31 52|directional TOPO overhang 53|0 55|5529 56|5532 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2410000" 50 45 51|33 52|f1 origin 53|0 55|442 56|870 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|4 52|Neo(R) 53|0 55|1280 56|2074 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1260000" 50 45 51|33 52|pUC origin 53|1 55|2763 56|3436 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|29 52|SV40 early promoter 53|0 55|875 56|1244 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|25 52|SV40 pA 53|0 55|2250 56|2380 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|27 52|T7 primer 53|0 55|5440 56|5459 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|5440 56|5456 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|25 52|TK pA 53|0 55|135 56|406 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1860000" 50 45 51|27 52|TK pA reverse primer 53|1 55|142 56|160 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2120000" 50 45 51|31 52|TOPO binding site 53|1 55|1 56|5 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2460000" 50 45 51|31 52|TOPO binding site 53|0 55|5524 56|5528 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2470000" 50 45 51|27 52|V5 reverse primer 53|1 55|76 56|96 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|67 56|108 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|4 52|3 stops 53|0 55|118 56|126 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000001" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|aagggtgggcgcgccgacccagctttcttgtacaaagtggttgatctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggttagtaatgagtttaaacgggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacgggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagaccccattggggccaatacgcccgcgtttcttccttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagcagatctgcgcagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcag 209|cgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaa 209|aaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatac 209|gggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtcgacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaagctatcaacaagtttgtacaaaaaagcaggctccgcggccgcccccttcacc 210 212 25|pcDNA6.2/V5-DEST 278|GenBank 27|0 222|1 33|7341 236|38836800 237|326807314 26|913 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|7341 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="701" 50 45 51|4 52|Amp(R) 53|1 55|6345 56|7205 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|911 56|1035 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|3051 56|3175 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|1 55|7206 56|7304 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|Bsd(R) 53|0 55|4461 56|4859 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1050000" 50 45 51|4 52|ccdB 53|1 55|1464 56|1769 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|1 55|2111 56|2770 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|CMV forward primer 53|0 55|769 56|789 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|232 56|819 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2180000" 50 45 51|30 52|EM7 promoter 53|0 55|4393 56|4460 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2340000" 50 45 51|33 52|f1 origin 53|0 55|3576 56|4004 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|33 52|pUC origin 53|1 55|5530 56|6200 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|29 52|SV40 early promoter 53|0 55|4009 56|4378 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|25 52|SV40 pA 53|0 55|5017 56|5147 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|27 52|T7 primer 53|0 55|863 56|882 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|863 56|879 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|25 52|TK pA 53|0 55|3269 56|3540 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1860000" 50 45 51|27 52|TK pA reverse primer 53|1 55|3276 56|3294 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2120000" 50 45 51|27 52|V5 reverse primer 53|1 55|3210 56|3230 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|3201 56|3242 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|4 52|3 stops 53|0 55|3252 56|3260 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000001" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaagctatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgat 209|aaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagtccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcacacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcga 209|taactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggttagtaatgagtttaaacgggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacgggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagaccccattggggccaatacgcccgcgtttcttccttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagcagatctgcgcagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatc 209|ccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctgcatcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtgggagggctaagcacttcgtggccgaggagcaggactgacacgtgctacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggct 209|ccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaag 209|tgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc 210 212 25|pcDNA6.2/V5-GW/D-TOPO 278|GenBank 27|1 222|1 33|5162 236|38836800 237|326807314 26|914 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|5162 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="740" 50 45 51|4 52|Amp(R) 53|1 55|3211 56|4071 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attB1 53|0 55|5118 56|5142 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2650000" 50 45 51|86 52|attB2 53|1 55|17 56|41 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2660000" 50 45 51|30 52|bla promoter 53|1 55|4072 56|4170 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|Bsd(R) 53|0 55|1327 56|1725 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1050000" 50 45 51|27 52|CMV forward primer 53|0 55|4976 56|4996 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|4439 56|5026 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2180000" 50 45 51|31 52|directional TOPO overhang 53|0 55|5159 56|5162 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2410000" 50 45 51|30 52|EM7 promoter 53|0 55|1259 56|1326 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2340000" 50 45 51|33 52|f1 origin 53|0 55|442 56|870 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|33 52|pUC origin 53|1 55|2396 56|3066 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|29 52|SV40 early promoter 53|0 55|875 56|1244 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|25 52|SV40 pA 53|0 55|1883 56|2013 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|27 52|T7 primer 53|0 55|5070 56|5089 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|5070 56|5086 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|25 52|TK pA 53|0 55|135 56|406 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1860000" 50 45 51|27 52|TK pA reverse primer 53|1 55|142 56|160 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2120000" 50 45 51|31 52|TOPO binding site 53|1 55|1 56|5 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2460000" 50 45 51|31 52|TOPO binding site 53|0 55|5154 56|5158 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2470000" 50 45 51|27 52|V5 reverse primer 53|1 55|76 56|96 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|67 56|108 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|4 52|3 stops 53|0 55|118 56|126 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000001" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|aagggtgggcgcgccgacccagctttcttgtacaaagtggttgatctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggttagtaatgagtttaaacgggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacgggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagaccccattggggccaatacgcccgcgtttcttccttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagcagatctgcgcagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccat 209|ctctgaagactacagcgtcgccagcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctgcatcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtgggagggctaagcacttcgtggccgaggagcaggactgacacgtgctacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactg 209|gcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacc 209|tgacgtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagttaagctatcaacaagtttgtacaaaaaagcaggctccgcggccgcccccttcacc 210 212 25|pDEST10 278|GenBank 27|0 222|1 33|6708 236|38836800 237|326807315 26|925 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|6708 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="574" 50 45 51|4 52|Amp(R) 53|0 55|3509 56|4369 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|337 56|461 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2058 56|2182 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|3410 56|3508 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1712 56|2017 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|711 56|1370 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|f1 origin 53|0 55|2922 56|3377 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|4 52|Gm(R) 53|1 55|5722 56|6255 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1150000" 50 45 51|29 52|Pc promoter 53|1 55|6444 56|6471 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2250000" 50 45 51|29 52|PH promoter 53|0 55|116 56|244 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2260000" 50 45 51|27 52|Polyhedrin forward primer 53|0 55|132 56|149 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2060000" 50 45 51|33 52|pUC origin 53|0 55|4514 56|5187 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|25 52|SV40 pA 53|0 55|2304 56|2544 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1850000" 50 45 51|4 52|TEV recognition site 53|0 55|313 56|333 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1300000" 50 45 51|86 52|Tn7L 53|0 55|2563 56|2757 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2750000" 50 45 51|86 52|Tn7R 53|0 55|5432 56|5655 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2760000" 50 45 51|4 52|6xHis 53|0 55|274 56|291 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1015000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ccccggatgaagtggttcgcatcctcggttttctggaaggcgagcatcgtttgttcgcccaggactctagctatagttctagtggttggctacgtatactccggaatattaatagatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggcgcggatctcggtccgaaaccatgtcgtactaccatcaccatcaccatcacgattacgatatcccaacgaccgaaaacctgtattttcagggcatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgctaagttggcagcatcacccgacgcactttgcgccgaataaatacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttactaaaagccaga 209|taacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgatgccatggatccggaattcaaaggcctacgtcgacgagctcaactagtgcggccgctttcgaatctagagcctgcagtctcgaggcatgcggtaccaagcttgtcgagaagtactagaggatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatctgatcactgcttgagcctaggagatccgaaccagataagtgaaatctagttccaaactattttgtcatttttaattttcgtattagcttacgacgctacacccagttcccatctattttgtcactcttccctaaataatccttaaaaactccatttccacccctcccagttcccaactattttgtccgcccacagcggggcatttttcttcctgttatgtttttaatcaaacatcctgccaactccatgtgacaaa 209|ccgtcatcttcggctactttttctctgtcacagaatgaaaatttttctgtcatctcttcgttattaatgtttgtaattgactgaatatcaacgcttatttgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctga 209|taaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcagaccagccgcgtaacctggcaaaatcggttacggttgagtaataaatggatgccctgcgtaagcgggtgtgggcggacaataaagtcttaaactgaacaaaatagatctaaactatgacaataaagtcttaaactagacagaatagttgtaaactgaaatcagtccagttatgctgtgaaaaagcatactggacttttgttatggctaaagcaaactcttcattttctgaagtgcaa 209|attgcccgtcgtattaaagaggggcgtggccaagggcatggtaaagactatattcgcggcgttgtgacaatttaccgaacaactccgcggccgggaagccgatctcggcttgaacgaattgttaggtggcggtacttgggtcgatatcaaagtgcatcacttcttcccgtatgcccaactttgtatagagagccactgcgggatcgtcaccgtaatctgcttgcacgtagatcacataagcaccaagcgcgttggcctcatgcttgaggagattgatgagcgcggtggcaatgccctgcctccggtgctcgccggagactgcgagatcatagatatagatctcactacgcggctgctcaaacctgggcagaacgtaagccgcgagagcgccaacaaccgcttcttggtcgaaggcagcaagcgcgatgaatgtcttactacggagcaagttcccgaggtaatcggagtccggctgatgttgggagtaggtggctacgtctccgaactcacgaccgaaaagatcaagagcagcccgcatggatttgacttggtcagggccgagcctacatgtgcgaatgatgcccatacttgagccacctaactttgttttagggcgactgccctgctgcgtaacatcgttgctgctgcgtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgcttgctgcttggatgcccgaggcatagactgtacaaaaaaacagtcataacaagccatgaaaaccgccactgcgccgttaccaccgctgcgttcggtcaaggttctggaccagttgcgtgagcgcatacgctacttgcattacagtttacgaaccgaacaggcttatgtcaactgggttcgtgccttcatccgtttccacggtgtgcgtcacccggcaaccttgggcagcagcgaagtcgaggcatttctgtcctggctggcgaacgagcgcaaggtttcggtctccacgcatcgtcaggcattggcggccttgctgttcttctacggcaaggtgctgtgcacggatctgccctggcttcaggagatcggaagacctcggccgtcgcggcgcttgccggtggtgctga 210 212 25|pDEST14 278|GenBank 27|0 222|1 33|6422 236|38836800 237|326807315 26|926 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|6422 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="573" 50 45 51|4 52|Amp(R) 53|0 55|2638 56|3498 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|67 56|191 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|1788 56|1912 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|2539 56|2637 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1442 56|1747 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|441 56|1100 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|pBR322 origin 53|0 55|3643 56|4316 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|4 52|ROP 53|1 55|4687 56|4878 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1270000" 50 45 51|27 52|T7 primer 53|0 55|21 56|40 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|21 56|37 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|27 52|T7 reverse primer 53|1 55|1962 56|1981 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2110000" 50 45 51|43 52|T7 transcription terminator 53|0 55|1923 56|2051 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2630000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|agatctcgatcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgctaagttggcagcatcacccgacgcactttgcgccgaataaatacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattga 209|aatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgatgatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggatatccacaggacgggtgtggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatcc 209|ttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccac 209|ctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgc 209|caacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgatcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcg 210 212 25|pDEST15 278|GenBank 27|0 222|1 33|7013 236|38836800 237|326807315 26|927 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 576 53|0 55|1 56|7013 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="576" 50 45 51|4 52|Amp(R) 53|0 55|3233 56|4093 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|792 56|916 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2372 56|2496 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|3134 56|3232 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|2026 56|2331 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|1025 56|1684 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|pBR322 origin 53|0 55|4238 56|4911 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|4 52|ROP 53|1 55|5282 56|5473 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1270000" 50 45 51|27 52|T7 primer 53|0 55|25 56|44 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|25 56|41 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|27 52|T7 reverse primer 53|1 55|2557 56|2576 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2110000" 50 45 51|43 52|T7 transcription terminator 53|0 55|2518 56|2646 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2630000" 50 45 51|4 52|GST tag (no stop) 53|0 55|105 56|776 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1165000" 50 45 51|4 52|initiation ATG 53|0 55|105 56|107 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000000" 50 45 51|32 52|RBS 53|0 55|90 56|96 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000003" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|atcgagatctcgatcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacatatgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgatggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaacatgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttggatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagttgattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgatgttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggcctttgcagggctggcaagccacgtttggtggtggcgaccatcctccaaaatcggatctggttccgcgtccatggtcgaatcaaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgt 209|gttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatctagaggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtttgattcgacccgggatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggatatccacaggacgggtgtggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagca 209|cgccatagtgactggcgatgctgtcggaatggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaat 209|cccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaa 209|caactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgatcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcg 209|tccggcgtagagg 210 212 25|pDEST17 278|GenBank 27|0 222|1 33|6354 236|38836800 237|326807315 26|928 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 578 53|0 55|1 56|6354 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="578" 50 45 51|4 52|Amp(R) 53|0 55|2570 56|3430 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|140 56|264 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|1720 56|1844 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|2471 56|2569 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1374 56|1679 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|373 56|1032 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|pBR322 origin 53|0 55|3575 56|4248 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|4 52|ROP 53|1 55|4619 56|4810 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1270000" 50 45 51|27 52|T7 primer 53|0 55|21 56|40 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|21 56|37 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|27 52|T7 reverse primer 53|1 55|1894 56|1913 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2110000" 50 45 51|43 52|T7 transcription terminator 53|0 55|1855 56|1983 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2630000" 50 45 51|4 52|6xHis 53|0 55|113 56|130 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1015000" 50 45 51|4 52|initiation ATG 53|0 55|101 56|103 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000000" 50 45 51|32 52|RBS 53|0 55|86 56|92 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000003" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|agatctcgatcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacatatgtcgtactaccatcaccatcaccatcacctcgaatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaa 209|agagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgattcgaggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggatatccacaggacgggtgtggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcg 209|gtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaa 209|cgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaag 209|ttaggctggtaagagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgatcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcg 210 212 25|pDEST20 278|GenBank 27|0 222|1 33|7066 236|38836800 237|326807315 26|929 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|7066 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="580" 50 45 51|4 52|Amp(R) 53|0 55|3778 56|4638 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|842 56|966 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2422 56|2546 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|3679 56|3777 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|2076 56|2381 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|1075 56|1734 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|f1 origin 53|0 55|3191 56|3646 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|4 52|Gm(R) 53|1 55|5991 56|6524 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1150000" 50 45 51|4 52|GST tag (no stop) 53|0 55|161 56|832 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1170000" 50 45 51|29 52|Pc promoter 53|1 55|6713 56|6740 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2250000" 50 45 51|29 52|PH promoter 53|0 55|27 56|155 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2260000" 50 45 51|27 52|Polyhedrin forward primer 53|0 55|43 56|60 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2060000" 50 45 51|33 52|pUC origin 53|0 55|4783 56|5456 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|25 52|SV40 pA 53|0 55|2574 56|2814 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1850000" 50 45 51|86 52|Tn7L 53|0 55|2846 56|3027 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2730000" 50 45 51|86 52|Tn7R 53|0 55|5701 56|5924 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2760000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctacgtatactccggaatattaatagatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggcgcggatccatggcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgatggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaacatgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttggatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagttgattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgatgttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggcctttgcagggctggcaagccacgtttggtggtggcgaccatcctccaaaatcggatctggttccgcgtcataatcaaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggattttgagttaggatccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaata 209|ccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatctagaggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtttgatagcttgtcgagaagtactagaggatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatctt 209|atcatgtctggatctgatcactgcttgagcctaggagatccgaaccagataagtgaaatctagttccaaactattttgtcatttttaattttcgtattagcttacgacgctacacccagttcccatctattttgtcactcttccctaaataatccttaaaaactccatttccacccctcccagttcccaactattttgtccgcccacagcggggcatttttcttcctgttatgtttttaatcaaacatcctgccaactccatgtgacaaaccgtcatcttcggctactttttctctgtcacagaatgaaaatttttctgtcatctcttcgttattaatgtttgtaattgactgaatatcaacgcttatttgcagcctgaatggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcgga 209|ggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttct 209|ccttacgcatctgtgcggtatttcacaccgcagaccagccgcgtaacctggcaaaatcggttacggttgagtaataaatggatgccctgcgtaagcgggtgtgggcggacaataaagtcttaaactgaacaaaatagatctaaactatgacaataaagtcttaaactagacagaatagttgtaaactgaaatcagtccagttatgctgtgaaaaagcatactggacttttgttatggctaaagcaaactcttcattttctgaagtgcaaattgcccgtcgtattaaagaggggcgtggccaagggcatggtaaagactatattcgcggcgttgtgacaatttaccgaacaactccgcggccgggaagccgatctcggcttgaacgaattgttaggtggcggtacttgggtcgatatcaaagtgcatcacttcttcccgtatgcccaactttgtatagagagccactgcgggatcgtcaccgtaatctgcttgcacgtagatcacataagcaccaagcgcgttggcctcatgcttgaggagattgatgagcgcggtggcaatgccctgcctccggtgctcgccggagactgcgagatcatagatatagatctcactacgcggctgctcaaacctgggcagaacgtaagccgcgagagcgccaacaaccgcttcttggtcgaaggcagcaagcgcgatgaatgtcttactacggagcaagttcccgaggtaatcggagtccggctgatgttgggagtaggtggctacgtctccgaactcacgaccgaaaagatcaagagcagcccgcatggatttgacttggtcagggccgagcctacatgtgcgaatgatgcccatacttgagccacctaactttgttttagggcgactgccctgctgcgtaacatcgttgctgctgcgtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgcttgctgcttggatgcccgaggcatagactgtacaaaaaaacagtcataacaagccatgaaaaccgccactgcgccgttaccaccgctgcgttcggtcaaggttctggaccagttgcgtgagcgcatacgctacttgcattacagtttacgaaccgaacaggcttatgtcaactgggttcgtgccttcatccgtttccacggtgtgcgtcacccggcaaccttgggcagcagcgaagtcgaggcatttctgtcctggctggcgaacgagcgcaaggtttcggtctccacgcatcgtcaggcattggcggccttgctgttcttctacggcaaggtgctgtgcacggatctgccctggcttcaggagatcggaagacctcggccgtcgcggcgcttgccggtggtgctgaccccggatgaagtggttcgcatc 209|ctcggttttctggaaggcgagcatcgtttgttcgcccaggactctagctatagttctagtggttgg 210 212 25|pDEST22 27|0 222|1 33|8923 236|38836800 237|326807315 26|930 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|9-JUN-2003 1008|SYN 45 51|98 52|Invitrogen vector 665 53|0 55|1 56|8923 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="665" 50 45 51|4 52|Amp(R) 53|0 55|715 56|1575 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|4663 56|4787 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|6384 56|6508 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|616 56|714 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|6038 56|6343 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|5037 56|5696 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|f1 origin 53|0 55|7230 56|7685 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|4 52|Gal4 AD 53|0 55|4273 56|4662 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1110000" 50 45 51|33 52|pUC origin 53|0 55|1720 56|2393 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|4 52|TRP1 53|1 55|7782 56|8456 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1330000" 50 45 51|29 52|ADH1 promoter 53|0 55|2813 56|4264 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2221000" 50 45 51|43 52|ADH1 transcription terminator 53|0 55|6708 56|7039 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2565000" 50 45 51|5 52|ARS4/Cen6 53|0 55|68 56|443 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000099" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttaggacggatcgcttgcctgtaacttacacgcgcctcgtatcttttaatgatggaataatttgggaatttactctgtgtttatttatttttatgttttgtatttggattttagaaagtaaataaagaaggtagaagagttacggaatgaagaaaaaaaaataaacaaaggtttaaaaaatttcaacaaaaagcgtactttacatatatatttattagacaagaaaagcagattaaatagatatacattcgattaacgataagtaaaatgtaaaatcacaggattttcgtgtgtggtcttctacacagacaagatgaaacaattcggcattaatacctgagagcaggaagagcaagataaaaggtagtatttgttggcgatccccctagagtcttttacatcttcggaaaacaaaaactattttttctttaatttctttttttactttctatttttaatttatatatttatattaaaaaatttaaattataattatttttatagcacgtgatgaaaaggacccaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgctttttttcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttat 209|tgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgggcagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccaggggggaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggccgagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttacctcactcattaggcaccccaggctttacactttatgcttccggctcctatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagctcggaattaaccctcactaaagggaacaaaagctgggtaccgggcccc 209|ccctcgagatccgggatcgaagaaatgatggtaaatgaaataggaaatcaaggagcatgaaggcaaaagacaaatataagggtcgaacgaaaaataaagtgaaaagtgttgatatgatgtatttggctttgcggcgccgaaaaaacgagtttacgcaattgcacaatcatgctgactctgtggcggacccgcgctcttgccggcccggcgataacgctgggcgtgaggctgtgcccggcggagttttttgcgcctgcattttccaaggtttaccctgcgctaaggggcgagattggagaagcaataagaatgccggttggggttgcgatgatgacgaccacgacaactggtgtcattatttaagttgccgaaagaacctgagtgcatttgcaacatgagtatactagaagaatgagccaagacttgcgagacgcgagtttgccggtggtgcgaacaatagagcgaccatgaccttgaaggtgagacgcgcataaccgctagagtactttgaagaggaaacagcaatagggttgctaccagtataaatagacaggtacatacaacactggaaatggttgtctgtttgagtacgctttcaattcatttgggtgtgcactttattatgttacaatatggaagggaactttacacttctcctatgcacatatattaattaaagtccaatgctagtagagaaggggggtaacacccctccgcgctcttttccgatttttttctaaaccgtggaatatttcggatatccttttgttgtttccgggtgtacaatatggacttcctcttttctggcaaccaaacccatacatcgggattcctataataccttcgttggtctccctaacatgtaggtggcggaggggagatatacaatagaacagataccagacaagacataatgggctaaacaagactacaccaattacactgcctcattgatggtggtacataacgaactaatactgtagccctagacttgatagccatcatcatatcgaagtttcactaccctttttccatttgccatctattgaagtaataataggcgcatgcaacttcttttctttttttttcttttctctctcccccgttgttgtctcaccatatccgcaatgacaaaaaaaatgatggaagacactaaaggaaaaaattaacgacaaagacagcaccaacagatgtcgttgttccagagctgatgaggggtatcttcgaacacacgaaactttttccttccttcattcacgcacactactctctaatgagcaacggtatacggccttccttccagttacttgaatttgaaataaaaaaagtttgccgctttgctatcaagtataaatagacctgcaattattaatcttttgtttcctcgtcattgttctcgt 209|tccctttcttccttgtttctttttctgcacaatatttcaagctataccaagcatacaatcaactccaagcttatgcccaagaagaagcggaaggtctcgagcggcgccaattttaatcaaagtgggaatattgctgatagctcattgtccttcactttcactaacagtagcaacggtccgaacctcataacaactcaaacaaattctcaagcgctttcacaaccaattgcctcctctaacgttcatgataacttcatgaataatgaaatcacggctagtaaaattgatgatggtaataattcaaaaccactgtcacctggttggacggaccaaactgcgtataacgcgtttggaatcactacagggatgtttaataccactacaatggatgatgtatataactatctattcgatgatgaagataccccaccaaacccaaaaaaagagggtgggtcgaatcaaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgctaagttggcagcatcacccgacgcactttgcgccgaataaatacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcg 209|attcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatctagaggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtttgatggccgctaagtaagtaagacgtcgagctctaagtaagtaacggccgccaccgcggtggagctttggacttcttcgccagaggtttggtcaagtctccaatcaaggttgtcggcttgtctaccttgccagaaatttacgaaaagatggaaaagggtcaaatcgttggtagatacgttgttgacacttctaaataagcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaaattcttgttcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagcatgaggtcgctcttattgaccacacctctaccggcatgccgagcaaatgcctgcaaatcgctccccatttcacccaattgtagatatgctaactccagcaatgagttgatgaatctcggtgtgtattttatgtcctcag 209|aggacaatacctgttgtaatcgttcttccacacggatcccaattcgccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcaggcaagtgcacaaacaatacttaaataaatactactcagtaataacctatttcttagcatttttgacgaaatttgctattttgttagagtcttttacaccatttgtctccacacctccgcttacatcaacaccaataacgccatttaatctaagcgcatcaccaacattttctggcgtcagtccaccagctaacataaaatgtaagctttcggggctctcttgccttccaacccagtcagaaatcgagttccaatccaaaagttcacctgtcccacctgcttctgaatcaaacaagggaataaacgaatgaggtttctgtgaagctgcactgagtagtatgttgcagtcttttggaaatacgagtcttttaataactggcaaaccgaggaactcttggtattcttgccacgactcatctccatgcagttggacgatatcaatgccgtaatcattgaccagagccaaaacatcctccttaggttgattacgaaacacgccaaccaagtatttcggagtgcctgaactatttttatatgcttttacaagacttgaaattttccttgcaataaccgggtcaattgttctctttctattgggcacacatataatacccagcaagtcagcatcggaatctagagcacattctgcggcctctgtgctctgc 209|aagccgcaaactttcaccaatggaccagaactacctgtgaaattaataacagacatactccaagctgcctttgtgtgcttaatcacgtatactcacgtgctcaatagtcaccaatgccctccctcttggccctctccttttcttttttcgaccgaattaattcttaatcggcaaaaaaagaaaagctccggatcaagattgtacgtaaggtgacaagctatttttcaataaagaatatcttccactactgccatctggcgtcataactgcaaagtacacatatattacgatgctgtctattaaatgcttcctatattatatatatagtaatgtcgtttatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga 210 212 25|pDEST24 278|GenBank 27|0 222|1 33|6961 236|38836800 237|326807315 26|931 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 673 53|0 55|1 56|6961 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="673" 50 45 51|4 52|Amp(R) 53|0 55|3181 56|4041 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|71 56|195 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|1651 56|1775 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|3082 56|3180 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1305 56|1610 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|304 56|963 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|pBR322 origin 53|0 55|4186 56|4859 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|4 52|ROP 53|1 55|5230 56|5421 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1270000" 50 45 51|27 52|T7 primer 53|0 55|25 56|44 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|25 56|41 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|43 52|T7 transcription terminator 53|0 55|2466 56|2594 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2630000" 50 45 51|4 52|GST tag (no ATG) 53|0 55|1783 56|2472 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1166000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|atcgagatctcgatcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatg 209|gtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgattatgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgatggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaacatgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttggatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagttgattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgatgttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggcctttgcagggctggcaagccacgtttggtggtggcgaccatcctccaaaatcggatctggttccgcgtccatggggatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggatatccacaggacgggtgtggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatcccgcaagaggcc 209|cggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatc 209|aaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaat 209|gccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgatcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagagg 210 212 25|pDEST26 278|GenBank 27|0 222|1 33|7481 236|38836800 237|326807315 26|932 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 581 53|0 55|1 56|7481 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="581" 50 45 51|4 52|Amp(R) 53|0 55|5417 56|6277 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|671 56|795 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2251 56|2375 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|5318 56|5416 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1905 56|2210 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|904 56|1563 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|CMV forward primer 53|0 55|473 56|493 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|15 56|608 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2190000" 50 45 51|33 52|f1 origin 53|0 55|3118 56|3573 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|27 52|M13 (-20) forward primer 53|1 55|2438 56|2453 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|1 55|2457 56|2473 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|4 52|Neo(R) 53|0 55|4100 56|4894 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1260000" 50 45 51|25 52|synthetic pA 53|0 55|4958 56|5006 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1820000" 50 45 51|33 52|pUC origin 53|0 55|6422 56|7095 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|25 52|SV40 pA 53|0 55|2726 56|2992 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1830000" 50 45 51|27 52|T7 primer 53|1 55|2407 56|2426 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|2410 56|2426 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|4 52|6xHis 53|0 55|644 56|661 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1015000" 50 45 51|29 52|SV40 early promoter 53|0 55|3733 56|4041 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|cattagatgcatgtcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggactctagcctaggccgcggaccatggcgtactaccatcaccatcaccatcactctagatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaactt 209|cttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatcgcgtgcatgcgacgtcatagctctctccctatagtgagtcgtattataagctaggcactggccgtcgttttacaacgtcgtgactgggaaaactgctagcttgggatctttgtgaaggaaccttacttctgtggtgtgacataattggacaaactacctacagagatttaaagctctaaggtaaatataaaatttttaagtgtataatgtgttaaactagctgcatatgcttgctgcttgagagttttgcttactgagtatgatttatgaaaatattatacacaggagctagtgattctaattgtttgtgtattttagattcacagtcccaaggctcatttcaggcccctcagtcctcacagtctgttcatgatcataatcagccataccacatttgtagaggttttacttgctttaaaa 209|aacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatcgatcctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattggctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaatatttaacgcgaattttaacaaaatattaacgtttacaatttcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatacgcggatctgcgcagcaccatggcctgaaataacctctgaaagaggaacttggttaggtaccttctgaggcggaaagaaccagctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagcttgattcttctgacacaacagtctcgaacttaaggctagagccaccatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgc 209|cgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgatggccgcaataaaatatctttattttcattacatctgtgtgttggttttttgtgtgaatcgatagcgataaggatccgcgtatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaag 209|aacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattt 209|ttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagagcttgcaattcgcgcgtttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtagtacgaggccctttcact 210 212 25|pDEST27 278|GenBank 27|0 222|1 33|8123 236|38836800 237|326807315 26|933 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 582 53|0 55|1 56|8123 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="582" 50 45 51|4 52|Amp(R) 53|0 55|6059 56|6919 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|1313 56|1437 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2893 56|3017 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|5960 56|6058 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|2547 56|2852 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|1546 56|2205 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|29 52|CMV promoter 53|0 55|15 56|608 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2190000" 50 45 51|33 52|f1 origin 53|0 55|3760 56|4215 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|4 52|GST tag (no stop) 53|0 55|632 56|1303 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1170000" 50 45 51|27 52|M13 (-20) forward primer 53|1 55|3080 56|3095 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|1 55|3099 56|3115 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|4 52|Neo(R) 53|0 55|4742 56|5536 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1260000" 50 45 51|25 52|synthetic pA 53|0 55|5600 56|5648 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1820000" 50 45 51|33 52|pUC origin 53|0 55|7064 56|7737 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|25 52|SV40 pA 53|0 55|3368 56|3634 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1830000" 50 45 51|27 52|T7 primer 53|1 55|3049 56|3068 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|3052 56|3068 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|29 52|SV40 early promoter 53|0 55|4375 56|4683 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|cattagatgcatgtcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggactctagcctaggccgcggaccatggcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgatggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaacatgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttggatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagttgattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgatgttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggcctttgcagggctggcaagccacgtttggtggtggcgaccatcctccaaaatcggatctggttccgcgttctagatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagacta 209|cataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagcca 209|ccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatcgcgtgcatgcgacgtcatagctctctccctatagtgagtcgtattataagctaggcactggccgtcgttttacaacgtcgtgactgggaaaactgctagcttgggatctttgtgaaggaaccttacttctgtggtgtgacataattggacaaactacctacagagatttaaagctctaaggtaaatataaaatttttaagtgtataatgtgttaaactagctgcatatgcttgctgcttgagagttttgcttactgagtatgatttatgaaaatattatacacaggagctagtgattctaattgtttgtgtattttagattcacagtcccaaggctcatttcaggcccctcagtcctcacagtctgttcatgatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatcgatcctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattggctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaatatttaacgcgaattttaacaaaatat 209|taacgtttacaatttcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatacgcggatctgcgcagcaccatggcctgaaataacctctgaaagaggaacttggttaggtaccttctgaggcggaaagaaccagctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagcttgattcttctgacacaacagtctcgaacttaaggctagagccaccatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgatggccgca 209|ataaaatatctttattttcattacatctgtgtgttggttttttgtgtgaatcgatagcgataaggatccgcgtatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatc 209|ctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagagcttgcaattcgcgcgtttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtagtacgaggccctttcact 210 212 25|pDEST32 27|0 222|1 33|12288 236|38836800 237|326807315 26|934 28|0 219|0 220|1 221|1 29|0 30|1 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|9-JUN-2003 1008|SYN 45 51|98 52|Invitrogen vector 666 53|0 55|1 56|12288 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="666" 50 45 51|86 52|attR1 53|0 55|6792 56|6916 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|8513 56|8637 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|4 52|ccdB 53|0 55|8167 56|8472 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|7166 56|7825 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|f1 origin 53|0 55|9359 56|9814 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|4 52|Gal4 DBD 53|0 55|6336 56|6791 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1120000" 50 45 51|4 52|Gm(R) 53|0 55|1450 56|1983 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1150000" 50 45 51|4 52|LEU2 53|0 55|10520 56|11626 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1250000" 50 45 51|43 52|CYC1 transcription terminator 53|1 55|3399 56|3647 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2560000" 50 45 51|29 52|Pc promoter 53|0 55|1234 56|1261 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2250000" 50 45 51|33 52|pUC origin 53|0 55|2313 56|2986 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|ADH1 transcription terminator 53|0 55|8837 56|9168 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2565000" 50 45 51|29 52|ADH1 promoter 53|0 55|4857 56|6308 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2221000" 50 45 51|4 52|CYH2 53|1 55|3940 56|4389 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1335000" 50 45 51|29 52|CYH2 promoter 53|1 55|4390 56|4705 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2222000" 50 45 51|50 52|CYH2 3' UTR 53|1 55|3755 56|3939 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000098" 50 45 51|5 52|ARS4/Cen6 53|0 55|68 56|443 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000099" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttaggacggatcgcttgcctgtaacttacacgcgcctcgtatcttttaatgatggaataatttgggaatttactctgtgtttatttatttttatgttttgtatttggattttagaaagtaaataaagaaggtagaagagttacggaatgaagaaaaaaaaataaacaaaggtttaaaaaatttcaacaaaaagcgtactttacatatatatttattagacaagaaaagcagattaaatagatatacattcgattaacgataagtaaaatgtaaaatcacaggattttcgtgtgtggtcttctacacagacaagatgaaacaattcggcattaatacctgagagcaggaagagcaagataaaaggtagtatttgttggcgatccccctagagtcttttacatcttcggaaaacaaaaactattttttctttaatttctttttttactttctatttttaatttatatatttatattaaaaaatttaaattataattatttttatagcacgtgatgaaaaggacccaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatctgcagtgcgcagggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcttgctggaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcggtagccaaccactagaactatagctagagtcctgggcgaacaaacgatgctcgccttccagaaaaccgaggatgcgaaccacttcatccggggtcagcaccaccggcaagcgccgcgacggccgaggtcttccgatctcctgaagccagggcagatccgtgcacagcaccttgccgtagaagaacagcaaggccgccaatgcctgacgatgcgtggagaccgaaaccttgcgctcgttcgccagccaggacagaaatgcctcgacttcgctgctgcccaaggttgccgggtgacgcacaccgtggaaacggatgaaggcacgaacccagttgacataagcctgttcggttcgtaaactgtaatgcaagtagcgtatgcgctcacgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcatggcttgttatgactgtttttttgtacagtctatgcctcgggcatccaagcag 209|caagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggtggctcaagtatgggcatcattcgcacatgtaggctcggccctgaccaagtcaaatccatgcgggctgctcttgatcttttcggtcgtgagttcggagacgtagccacctactcccaacatcagccggactccgattacctcgggaacttgctccgtagtaagacattcatcgcgcttgctgccttcgaccaagaagcggttgttggcgctctcgcggcttacgttctgcccaggtttgagcagccgcgtagtgagatctatatctatgatctcgcagtctccggcgagcaccggaggcagggcattgccaccgcgctcatcaatctcctcaagcatgaggccaacgcgcttggtgcttatgtgatctacgtgcaagcagattacggtgacgatcccgcagtggctctctatacaaagttgggcatacgggaagaagtgatgcactttgatatcgacccaagtaccgccacctaacaattcgttcaagccgagatcggcttcccggcctaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgncatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaac 209|aggagagcgcacgagggagcttccaggggggaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggccgagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttacctcactcattaggcaccccaggctttacactttatgcttccggctcctatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagctcggaattaaccctcactaaagggaacaaaagctggtaccgatcccgagctttgcaaattaaagccttcgagcgtcccaaaaccttctcaagcaaggttttcagtataatgttacatgcgtacacgcgtctgtacagaaaaaaaagaaaaatttgaaatataaataacgttcttaatactaacataactataaaaaaataaatagggacctagacttcaggttgtctaactccttccttttcggttagagcggatgtggggggagggcgtgaatgtaagcgtgacataactaattacatgatatcgacaaaggaaaaggggcctgtttactcacaggcttttttcaagtaggtaattaagtcgtttctgtctttttccttcttcaacccaccaaaggccatcttggtacttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttcatagaaataatacagaagtagatgttgaattagattaaactgaagatatataatttattggaaaatacatagagctttttgttgatgcgcttaagcgatcaattcaacaacaccaccagcagctctgattttttcttcagccaacttggagacgaatctagctttgacgataactggaacatttggaattctacccttacccaagatcttaccgtaaccggctgccaaagtgtcaataactggagcagtttccttagaagcagatttcaagtattggtctctcttgtcttctgggatcaatgtccacaatttgtccaagttcaagactggcttccagaaatgagcttgttg 209|cttgtggaagtatctcataccaaccttaccgaaataacctggatggtatttatccatgttaattctgtggtgatgttgaccaccggccatacctctaccaccggggtgctttctgtgcttaccgatacgacctttaccggctgagacgtgacctctgtgctttctagtcttagtgaatctggaaggcattcttgattagttggatgattgttctgggatttaatgcaaaaatcacttaagaaggaaaatcaacggagaaagcaaacgccatcttaaatatacgggatacagatgaaagggtttgaacctatctggaaaatagcattaaacaagcgaaaaactgcgaggaaaattgtttgcgtctctgcgggctattcacgcgccagaggaaaataggaaaaataacagggcattagaaaaataattttgattttggtaatgtgtgggtcctggtgtacagatgttacattggttacagtactcttgtttttgctgtgtttttcgatgaatctccaaaatggttgttagcacatggaagagtcaccgatgctaagttatctctatgtaagctacgtggcgtgacttttgatgaagccgcacaagagatacaggattggcaactgcaaatagaatctggggatcccccctcgagatccgggatcgaagaaatgatggtaaatgaaataggaaatcaaggagcatgaaggcaaaagacaaatataagggtcgaacgaaaaataaagtgaaaagtgttgatatgatgtatttggctttgcggcgccgaaaaaacgagtttacgcaattgcacaatcatgctgactctgtggcggacccgcgctcttgccggcccggcgataacgctgggcgtgaggctgtgcccggcggagttttttgcgcctgcattttccaaggtttaccctgcgctaaggggcgagattggagaagcaataagaatgccggttggggttgcgatgatgacgaccacgacaactggtgtcattatttaagttgccgaaagaacctgagtgcatttgcaacatgagtatactagaagaatgagccaagacttgcgagacgcgagtttgccggtggtgcgaacaatagagcgaccatgaccttgaaggtgagacgcgcataaccgctagagtactttgaagaggaaacagcaatagggttgctaccagtataaatagacaggtacatacaacactggaaatggttgtctgtttgagtacgctttcaattcatttgggtgtgcactttattatgttacaatatggaagggaactttacacttctcctatgcacatatattaattaaagtccaatgctagtagagaaggggggtaacacccctccgcgctcttttccgatttttttctaaaccgtggaatatttcg 209|gatatccttttgttgtttccgggtgtacaatatggacttcctcttttctggcaaccaaacccatacatcgggattcctataataccttcgttggtctccctaacatgtaggtggcggaggggagatatacaatagaacagataccagacaagacataatgggctaaacaagactacaccaattacactgcctcattgatggtggtacataacgaactaatactgtagccctagacttgatagccatcatcatatcgaagtttcactaccctttttccatttgccatctattgaagtaataataggcgcatgcaacttcttttctttttttttcttttctctctcccccgttgttgtctcaccatatccgcaatgacaaaaaaaatgatggaagacactaaaggaaaaaattaacgacaaagacagcaccaacagatgtcgttgttccagagctgatgaggggtatcttcgaacacacgaaactttttccttccttcattcacgcacactactctctaatgagcaacggtatacggccttccttccagttacttgaatttgaaataaaaaaagtttgccgctttgctatcaagtataaatagacctgcaattattaatcttttgtttcctcgtcattgttctcgttccctttcttccttgtttctttttctgcacaatatttcaagctataccaagcatacaatcaactccaagcttgaagcaagcctcctgaaagatgaagctactgtcttctatcgaacaagcatgcgatatttgccgacttaaaaagctcaagtgctccaaagaaaaaccgaagtgcgccaagtgtctgaagaacaactgggagtgtcgctactctcccaaaaccaaaaggtctccgctgactagggcacatctgacagaagtggaatcaaggctagaaagactggaacagctatttctactgatttttcctcgagaagaccttgacatgattttgaaaatggattctttacaggatataaaagcattgttaacaggattatttgtacaagataatgtgaataaagatgccgtcacagatagattggcttcagtggagactgatatgcctctaacattgagacagcatagaataagtgcgacatcatcatcggaagagagtagtaacaaaggtcaaagacagttgactgtatcgtcgaggtcgaatcaaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgctaagttggcagcatcacccgacgcactttgcgccgaataaatacctgtgacggaagatcacttcgcagaataaata 209|aatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatctagaggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaa 209|gaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtttgatggccgctaagtaagtaagacgtcgagctctaagtaagtaacggccgccaccgcggtggagctttggacttcttcgccagaggtttggtcaagtctccaatcaaggttgtcggcttgtctaccttgccagaaatttacgaaaagatggaaaagggtcaaatcgttggtagatacgttgttgacacttctaaataagcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaaattcttgttcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagcatgaggtcgctcttattgaccacacctctaccggcatgccgagcaaatgcctgcaaatcgctccccatttcacccaattgtagatatgctaactccagcaatgagttgatgaatctcggtgtgtattttatgtcctcagaggacaatacctgttgtaatcgttcttccacacggatcccaattcgccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatatt 209|aacgtttacaatttcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatcgaccggtcgaggagaacttctagtatatccacatacctaatattattgccttattaaaaatggaatcggaacaattacatcaaaatccacattctcttcaaaatcaattgtcctgtacttccttgttcatgtgtgttcaaaaacgttatatttataggataattatactctatttctcaacaagtaattggttgtttggccgagcggtctaaggcgcctgattcaagaaatatcttgaccgcagttaactgtgggaatactcaggtatcgtaagatgcaagagttcgaatctcttagcaaccattatttttttcctcaacataacgagaacacacaggggcgctatcgcacagaatcaaattcgatgactggaaattttttgttaatttcagaggtcgcctgacgcatatacctttttcaactgaaaaattgggagaaaaaggaaaggtgagaggccggaaccggcttttcatatagaatagagaagcgttcatgactaaatgcttgcatcacaatacttgaagttgacaatattatttaaggacctattgttttttccaataggtggttagcaatcgtcttactttctaacttttcttaccttttacatttcagcaatatatatatatatttcaaggatataccattctaatgtctgcccctatgtctgcccctaagaagatcgtcgttttgccaggtgaccacgttggtcaagaaatcacagccgaagccattaaggttcttaaagctatttctgatgttcgttccaatgtcaagttcgatttcgaaaatcatttaattggtggtgctgctatcgatgctacaggtgtcccacttccagatgaggcgctggaagcctccaagaaggttgatgccgttttgttaggtgctgtgggtggtcctaaatggggtaccggtagtgttagacctgaacaaggtttactaaaaatccgtaaagaacttcaattgtacgccaacttaagaccatgtaactttgcatccgactctcttttagacttatctccaatcaagccacaatttgctaaaggtactgacttcgttgttgtcagagaattagtgggaggtatttactttggtaagagaaaggaagacgatggtgatggtgtcgcttgggatagtgaacaatacaccgttccagaagtgcaaagaatcacaagaatggccgctttcatggccctacaacatgagccaccattgcctatttggtccttggataaagctaatgttttggcctcttcaagattatggagaaaaactgtggaggaaaccatcaagaacgaattccctacattgaaggttcaacatcaattg 209|attgattctgccgccatgatcctagttaagaacccaacccacctaaatggtattataatcaccagcaacatgtttggtgatatcatctccgatgaagcctccgttatcccaggttccttgggtttgttgccatctgcgtccttggcctctttgccagacaagaacaccgcatttggtttgtacgaaccatgccacggttctgctccagatttgccaaagaataaggttgaccctatcgccactatcttgtctgctgcaatgatgttgaaattgtcattgaacttgcctgaagaaggtaaggccattgaagatgcagttaaaaaggttttggatgcaggtatcagaactggtgatttaggtggttccaacagtaccaccgaagtcggtgatgctgtcgccgaagaagttaagaaaatccttgcttaaaaagattctctttttttatgatatttgtacataaactttataaatgaaattcataatagaaacgacacgaaattacaaaatggaatatgttcatagggtagacgaaactatatacgcaatctacatacatttatcaagaaggagaaaaaggaggatagtaaaggaatacaggtaagcaaattgatactaatggctcaacgtgataaggaaaaagaattgcactttaacattaatattgacaaggaggagggcaccacacaaaaagttaggtgtaacagaaaatcatgaaactacgattcctaatttgatattggaggattttctctaaaaaaaaaaaaatacaacaaataaaaaacactcaatgacctgaccatttgatggagtttaagtcaataccttcttgaaccatttcccataatggtgaaagttccctcaagaattttactctgtcagaaacggccttacgacgtagtcgatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga 210 212 25|pDEST8 278|GenBank 27|0 222|1 33|6526 236|38836800 237|326807315 26|935 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|6526 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="579" 50 45 51|4 52|Amp(R) 53|0 55|3235 56|4095 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|160 56|284 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|1881 56|2005 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|3136 56|3234 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1535 56|1840 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|534 56|1193 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|f1 origin 53|0 55|2648 56|3103 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|4 52|Gm(R) 53|1 55|5448 56|5981 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1150000" 50 45 51|29 52|Pc promoter 53|1 55|6170 56|6197 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2250000" 50 45 51|29 52|PH promoter 53|0 55|24 56|152 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2260000" 50 45 51|27 52|Polyhedrin forward primer 53|0 55|40 56|57 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2060000" 50 45 51|33 52|pUC origin 53|0 55|4240 56|4913 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|25 52|SV40 pA 53|0 55|2031 56|2271 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1850000" 50 45 51|86 52|Tn7L 53|0 55|2300 56|2484 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2740000" 50 45 51|86 52|Tn7R 53|0 55|5157 56|5381 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2770000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|cgtatactccggaatattaatagatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggcgcggatcatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgctaagttggcagcatcacccgacgcactttgcgccgaataaatacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaag 209|cacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgatagcttgtcgagaagtactagaggatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatctgatcactgcttgagcctaggagatccgaaccagataagtgaaatctagttccaaactattttgtcatttttaattttcgtattagcttacgacgctacacccagttcccatctattttgtcactcttccctaaataatccttaaaaactccatttccacccctcccagttcccaactattttgtccgcccacagcggggcatttttcttcctgttatgtttttaatcaaacatcctgccaactccatgtgacaaaccgtcatcttcggctactttttctctgtcacagaatgaaaatttttctgtcatctcttcgttattaatgtttgtaattgactgaatatcaacgcttatttgcagcctgaatggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatc 209|gggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaa 209|atcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcagaccagccgcgtaacctggcaaaatcggttacggttgagtaataaatggatgccctgcgtaagcgggtgtgggcggacaataaagtcttaaactgaacaaaatagatctaaactatgacaataaagtcttaaactagacagaatagttgtaaactgaaatcagtccagttatgctgtgaaaaagcatactggacttttgttatggctaaagcaaactcttcattttctgaagtgcaaattgcccgtcgtattaaagaggggcgtggccaagggcatggtaaagactatattcgcggcgttgtgacaatttaccgaacaactccgcggccgggaagccgatctcggcttgaacgaattgttaggtggcggtacttgggtcgatatcaaagtgcatcacttcttcccgtatgcccaactttgtatagagagccactgcgggatcgtcaccgtaatctgcttgcacgtagatcacataagcaccaagcgcgttggcctcatgcttgaggagatt 209|gatgagcgcggtggcaatgccctgcctccggtgctcgccggagactgcgagatcatagatatagatctcactacgcggctgctcaaacctgggcagaacgtaagccgcgagagcgccaacaaccgcttcttggtcgaaggcagcaagcgcgatgaatgtcttactacggagcaagttcccgaggtaatcggagtccggctgatgttgggagtaggtggctacgtctccgaactcacgaccgaaaagatcaagagcagcccgcatggatttgacttggtcagggccgagcctacatgtgcgaatgatgcccatacttgagccacctaactttgttttagggcgactgccctgctgcgtaacatcgttgctgctgcgtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgcttgctgcttggatgcccgaggcatagactgtacaaaaaaacagtcataacaagccatgaaaaccgccactgcgccgttaccaccgctgcgttcggtcaaggttctggaccagttgcgtgagcgcatacgctacttgcattacagtttacgaaccgaacaggcttatgtcaactgggttcgtgccttcatccgtttccacggtgtgcgtcacccggcaaccttgggcagcagcgaagtcgaggcatttctgtcctggctggcgaacgagcgcaaggtttcggtctccacgcatcgtcaggcattggcggccttgctgttcttctacggcaaggtgctgtgcacggatctgccctggcttcaggagatcggaagacctcggccgtcgcggcgcttgccggtggtgctgaccccggatgaagtggttcgcatcctcggttttctggaaggcgagcatcgtttgttcgcccaggactctagctatagttctagtggttggcta 210 212 25|pDESTR4-R3 278|GenBank 27|0 222|1 33|4107 236|38836800 237|326807315 26|936 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|10-APR-2003 45 51|98 52|Invitrogen vector 730 53|0 55|1 56|4107 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="730" 50 45 51|4 52|Amp(R) 53|0 55|2343 56|3203 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|30 52|bla promoter 53|0 55|2244 56|2342 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|1 55|201 56|506 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|1 55|848 56|1507 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|M13 (-20) forward primer 53|1 55|1749 56|1764 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|1 55|1768 56|1784 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|27 52|M13 reverse primer 53|0 55|1 56|17 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|86 52|attR4 53|0 55|37 56|161 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2702000" 50 45 51|86 52|attR3 53|1 55|1616 56|1740 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2701000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|caggaaacagctatgaccatgattacgccaagctatcaactttgtatagaaaagttgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggtcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggggactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcggcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccgaaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatcctctagattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacg 209|gtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgacggatcctaactcaaaatccacacattatacgagccggaagcataaagtgtaaagcctgggggtgcctaatgcggccgccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcaactttattatacatagttgataattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacat 209|gggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggtcttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccagcggataacaatttcaca 210 212 25|pDONR/Zeo 278|GenBank 27|0 222|1 33|4291 236|38836800 237|326807315 26|937 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|26-MAR-2003 45 51|98 52|Invitrogen vector 772 53|0 55|1 56|4291 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="772" 50 45 51|4 52|ccdB 53|1 55|1197 56|1502 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|1 55|1847 56|2506 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|Zeo(R) 53|1 55|3111 56|3485 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1370000" 50 45 51|27 52|M13 (-20) forward primer 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|27 52|M13 reverse primer 53|1 55|3027 56|3043 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|27 52|T7 primer 53|1 55|3003 56|3022 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|EM7 promoter 53|1 55|3486 56|3553 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2340000" 50 45 51|30 52|T7 promoter 53|1 55|3006 56|3022 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|86 52|attP1 53|0 55|570 56|801 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2685000" 50 45 51|86 52|attP2 53|1 55|2754 56|2985 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2686000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacacattgatgagcaatgcttttttataatgccaactttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggg 209|gatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggat 209|atgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaataatatcatcatgatcagtcctgctcctcggccacgaagtgcacgcagttgccggccgggtcgcgcagggcgaactcccgcccccacggctgctcgccgatctcggtcatggccggcccggaggcgtcccggaagttcgtggacacgacctccgaccactcggcgtacagctcgtccaggccgcgcacccacacccaggccagggtgttgtccggcaccacctggtcctggaccgcgctgatgaacagggtcacgtcgtcccggaccacaccggcgaagtcgtcctccacgaagtcccgggagaacccgagccggtcggtccagaactcgaccgctccggcgacgtcgcgcgcggtgagcaccggaacggcactggtcaacttggccatggtttagttcctcaccttgtcgtattatactatgccgatatactatgccgatgattaattgtcaacacgtgctgatcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgat 209|gctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONR201 278|GenBank 27|0 222|1 33|4470 236|38836800 237|326807315 26|938 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 34|Gateway Donor Vector. 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|21-MAY-2002 45 51|98 52|Invitrogen vector 584 53|0 55|1 56|4470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="584" 50 45 51|4 52|ccdB 53|1 55|959 56|1264 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|1 55|1606 56|2265 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|Kan(R) 53|0 55|2868 56|3677 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|232 56|275 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|73 56|100 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|86 52|attP1 53|0 55|332 56|563 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2685000" 50 45 51|86 52|attP2 53|1 55|2513 56|2744 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2686000" 50 45 51|27 52|pDONR™201 forward primer 53|0 55|300 56|324 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1991000" 50 45 51|27 52|pDONR™201 reverse primer 53|0 55|2769 56|2792 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1992000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaagtttgtacaaaaaagcagaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagtccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgct 209|taccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcacacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtgggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagctctggcccgtgtctcaaaatctctgatgttacattgcaca 209|agataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacct 209|acagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONR207 278|GenBank 27|0 222|1 33|5585 236|38836800 237|326807315 26|939 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|25-MAR-2003 45 51|98 52|Invitrogen vector 679 53|0 55|1 56|5585 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="679" 50 45 51|4 52|ccdB 53|1 55|959 56|1264 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|1 55|1606 56|2265 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|Gm(R) 53|1 55|3528 56|4061 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1150000" 50 45 51|29 52|Pc promoter 53|1 55|4250 56|4277 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2250000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|232 56|275 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|73 56|100 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|86 52|attP1 53|0 55|332 56|563 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2685000" 50 45 51|86 52|attP2 53|1 55|2513 56|2744 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2686000" 50 45 51|27 52|pDONR™207 forward primer 53|0 55|300 56|324 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1993000" 50 45 51|27 52|pDONR™207 reverse primer 53|1 55|2769 56|2792 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1994000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaagtttgtacaaaaaagcagaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagtccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgct 209|taccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcacacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtgggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagctctggcccgtgtctcaaaatctctgatgttacattgcaca 209|agataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaggccgggaagccgatctcggcttgaacgaattgttaggtggcggtacttgggtcgatatcaaagtgcatcacttcttcccgtatgcccaactttgtatagagagccactgcgggatcgtcaccgtaatctgcttgcacgtagatcacataagcaccaagcgcgttggcctcatgcttgaggagattgatgagcgcggtggcaatgccctgcctccggtgctcgccggagactgcgagatcatagatatagatctcactacgcggctgctcaaacctgggcagaacgtaagccgcgagagcgccaacaaccgcttcttggtcgaaggcagcaagcgcgatgaatgtcttactacggagcaagttcccgaggtaatcggagtccggctgatgttgggagtaggtggctacgtctccgaactcacgaccgaaaagatcaagagcagcccgcatggatttgacttggtcagggccgagcctacatgtgcgaatgatgcccatacttgagccacctaactttgttttagggcgactgccctgctgcgtaacatcgttgctgctgcgtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgcttgctgcttggatgcccgaggcatagactgtacaaaaaaacagtcataacaagccatgaaaaccgccactgcgccgttaccaccgctgcgttc 209|ggtcaaggttctggaccagttgcgtgagcgcatacgctacttgcattacagtttacgaaccgaacaggcttatgtcaactgggttcgtgccttcatccgtttccacggtgtgcgtcacccggcaaccttgggcagcagcgaagtcgaggcatttctgtcctggctggcgaacgagcgcaaggtttcggtctccacgcatcgtcaggcattggcggccttgctgttcttctacggcaaggtgctgtgcacggatctgccctggcttcaggagatcggaagacctcggccgtcgcggcgcttgccggtggtgctgaccccggatgaagtggttcgcatcctcggttttctggaaggcgagcatcgtttgttcgcccaggactctagctatagttctagtggttggctactaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONR221 278|GenBank 27|0 222|1 33|4762 236|38836800 237|326807315 26|940 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|25-MAR-2003 45 51|98 52|Invitrogen vector 722 53|0 55|1 56|4762 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="722" 50 45 51|4 52|ccdB 53|1 55|1197 56|1502 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|1 55|1847 56|2506 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|Kan(R) 53|0 55|3156 56|3965 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|27 52|M13 (-20) forward primer 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|27 52|M13 reverse primer 53|1 55|3027 56|3043 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|27 52|T7 primer 53|1 55|3003 56|3022 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|3006 56|3022 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|86 52|attP1 53|0 55|570 56|801 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2685000" 50 45 51|86 52|attP2 53|1 55|2754 56|2985 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2686000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacacattgatgagcaatgcttttttataatgccaactttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggg 209|gatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggat 209|atgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaataatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagc 209|taccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONR222 278|GenBank 27|0 222|1 33|4718 236|38836800 237|326807315 26|941 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|8-JAN-2003 1008|SYN 45 51|98 52|Invitrogen vector 763 53|0 55|1 56|4718 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="763" 50 45 51|4 52|ccdB 53|1 55|987 56|1292 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|27 52|M13 (-20) forward primer 53|0 55|327 56|342 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|0 55|307 56|323 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|27 52|M13 reverse primer 53|1 55|2816 56|2832 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|pUC origin 53|1 55|4045 56|4718 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|217 56|260 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|58 56|85 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|27 52|T7 primer 53|1 55|2792 56|2811 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|2795 56|2811 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|86 52|attP1 53|0 55|360 56|591 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2685000" 50 45 51|86 52|attP2 53|1 55|2543 56|2774 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2686000" 50 45 51|4 52|Cm(R) 53|1 55|1612 56|2295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|Kan(R) 53|1 55|2899 56|3714 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gtctgacgctcagggaacgacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgaatcaactacttagatggtattagtgacctgtagtcgaccgacagccttccaaatgttcttcgggtgatgctgccaacttagtcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataaggaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagac 209|gacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcggcgtttacgccccccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgactacaggtcactaataccatctaagtagttgattcatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgatatcccctatagt 209|gagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgttagaaaaactcatcgagcatcaaatgaaactgcaatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatggcaaaagcttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatgcaaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgttttcccggggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacatcattggcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcgatagattgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggcctcgagcaagacgtttcccgttgaatatggctcatagatcttttctccatcactgatagggagtggtaaaataactccatcaatgatagagtgtcaacaacatgaccaaaatcccttaacgtgagttacgcgtattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgttt 209|ccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggttacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggg 210 212 25|pDONRP2R-P3 278|GenBank 27|0 222|1 33|4773 236|38836800 237|326807315 26|942 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 34|Complementary copy of _pDONR™P2R-P3. 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|24-JUL-2002 45 51|98 52|Invitrogen vector 731 53|0 55|1 56|4773 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="731" 50 45 51|4 52|ccdB 53|0 55|2084 56|2389 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|1083 56|1742 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|Kan(R) 53|0 55|3167 56|3976 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|27 52|M13 (-20) forward primer 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|27 52|M13 reverse primer 53|1 55|3038 56|3054 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|27 52|T7 primer 53|1 55|3014 56|3033 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|3017 56|3033 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|86 52|attP2R 53|0 55|591 56|822 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2686001" 50 45 51|86 52|attP3 53|0 55|2746 56|2977 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2687000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccctgcagctctagagctcgaattctacaggtcactaataccatctaagtagttgattcatagtgactgcatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcaactttcttgtacaaagttggcattataaaaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttggagctctagagcgtcgactaagttggcagcatcacccgacgcactttgcgccgaataaatacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccgggaagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctgg 209|agtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatcgcgtggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgatacagtagaaattacagaaactttatcacgtttagtaagtatagaggctgaaaatccagatgaagccgaacgacttgtaagagaaaagtataagagttgtgaaattgttcttgatgcagatgattttcaggactatgacactagcgtatatgaataggtagatgtttttattttgtcacacaaaaaagaggctcgcacctctttttcttatttctttttatgatttaatacggcattgaggacaatagcgagtaggctggatacgacgattccgtttgagaagaacatttggaaggctgtcggtcgagctcgaattctacaggtcactaataccatctaagtagttgattcatagtgactgcatatgttgtg 209|ttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcaactttattatacaaagttggcattataaaaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttggagctccatggtagcgttaacgcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgcc 209|ggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pDONRP4-P1R 278|GenBank 27|0 222|1 33|4777 236|38836800 237|326807315 26|943 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 34|Ligation of ApaI-P4-ccdB-cat-P1R into pDONR™21 backbone. 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|24-JUL-2002 1008|SYN 45 51|98 52|Invitrogen vector 732 53|0 55|1 56|4777 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="732" 50 45 51|4 52|ccdB 53|1 55|1181 56|1486 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|1 55|1828 56|2487 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|Kan(R) 53|0 55|3171 56|3980 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|27 52|M13 (-20) forward primer 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|27 52|M13 reverse primer 53|1 55|3042 56|3058 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|27 52|T7 primer 53|1 55|3018 56|3037 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|3021 56|3037 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|86 52|attP4 53|1 55|593 56|824 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2688000" 50 45 51|86 52|attP1R 53|1 55|2748 56|2979 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2685001" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggcccgcgttaacgctaccatggagctccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgataagcaatgcttttttataatgccaactttgtatagaaaagttgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatgcagtcactatgaatcaactacttagatggtattagtgacctgtagaattcgagctcgaccgacagccttccaaatgttcttctcaaacggaatcgtcgtatccagcctactcgctattgtcctcaatgccgtattaaatcataaaaagaaataagaaaaagaggtgcgagcctcttttttgtgtgacaaaataaaaacatctacctattcatatacgctagtgtcatagtcctgaaaatcatctgcatcaagaacaatttcacaactcttatacttttctcttacaagtcgttcggcttcatctggattttcagcctctatacttactaaacgtgataaagtttctgtaatttctactgtatcgacctgcagactggctgtgtataagggagcctgacatttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgc 209|ccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagtccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcacacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagccggatccacgcgattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttagtcgacgctctagagctccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgat 209|aagcaatgcttttttataatgccaactttgtacaaaaaagttgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatgcagtcactatgaatcaactacttagatggtattagtgacctgtagaattcgagctctagagctgcagggcggccgcgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtt 209|tgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pEF-DEST51 278|GenBank 27|0 222|1 33|7464 236|38836800 237|326807315 26|944 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 630 53|0 55|1 56|7464 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="630" 50 45 51|4 52|6xHis 53|0 55|3501 56|3518 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1010000" 50 45 51|4 52|Amp(R) 53|1 55|6590 56|7450 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|1720 56|1844 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|3300 56|3424 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|26 52|BGH pA 53|0 55|3547 56|3771 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1870000" 50 45 51|27 52|BGH reverse primer 53|1 55|3541 56|3558 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1910000" 50 45 51|4 52|Bsd(R) 53|0 55|4703 56|5101 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1050000" 50 45 51|4 52|ccdB 53|0 55|2954 56|3259 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|1953 56|2612 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|EF-1alpha forward primer 53|0 55|1601 56|1621 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1940000" 50 45 51|30 52|EM7 promoter 53|0 55|4635 56|4702 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2340000" 50 45 51|33 52|f1 origin 53|0 55|3817 56|4245 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2500000" 50 45 51|33 52|pUC origin 53|1 55|5772 56|6445 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|29 52|SV40 early promoter 53|0 55|4250 56|4620 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|25 52|SV40 pA 53|0 55|5259 56|5389 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|27 52|T7 primer 53|0 55|1670 56|1689 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|1670 56|1686 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|27 52|V5 reverse primer 53|1 55|3459 56|3479 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|3450 56|3491 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|29 52|EF-1alpha promoter 53|0 55|470 56|1653 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2210000" 50 45 51|29 52|bla promoter 53|1 55|7451 56|85 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|aatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtcgacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactaggcttttgcaaaaagctttgcaaagatggataaagttttaaacagagaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgcctcgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactc 209|cacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgaggaattagcttggtactaatacgactcactatagggagacccaagctggctaggtaagcttgatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtca 209|atatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatctagagggcccgcggttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttggggatttcggcct 209|attggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgtcgacaggtgcttctcgatctgcatcctgggatcaaagcgatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtgggagggctaagcacttcgtggccgaggagcaggactgacacgtgctacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcat 209|taatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtg 209|caaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttc 210 212 25|pENTR/D-TOPO 278|GenBank 27|1 222|1 33|2580 236|38836800 237|326807315 26|946 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 662 53|0 55|1 56|2580 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="662" 50 45 51|86 52|attL1 53|0 55|2461 56|2560 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attL2 53|1 55|17 56|116 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 45 51|31 52|directional TOPO® overhang 53|0 55|2577 56|2580 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2410000" 50 45 51|4 52|Kan(R) 53|0 55|286 56|1095 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|27 52|M13 (-20) forward primer 53|0 55|2429 56|2444 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|0 55|2409 56|2425 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|27 52|M13 reverse primer 53|1 55|157 56|173 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|pUC origin 53|0 55|1216 56|1889 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|2319 56|2362 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|2160 56|2187 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|27 52|T7 primer 53|1 55|133 56|152 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|136 56|152 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|31 52|TOPO® binding site 53|1 55|1 56|5 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2460000" 50 45 51|31 52|TOPO® binding site 53|0 55|2572 56|2576 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2470000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|aagggtgggcgcgccgacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgta 209|gccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtacaaaaaagcaggctccgcggccgcccccttcacc 210 212 25|pENTR/SD/D-TOPO 278|GenBank 27|1 222|1 33|2601 236|38836800 237|326807315 26|947 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 663 53|0 55|1 56|2601 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="663" 50 45 51|86 52|attL1 53|0 55|2461 56|2560 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attL2 53|1 55|17 56|116 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 45 51|31 52|directional TOPO overhang 53|0 55|2598 56|2601 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2410000" 50 45 51|4 52|Kan(R) 53|0 55|286 56|1095 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|27 52|M13 (-20) forward primer 53|0 55|2429 56|2444 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|0 55|2409 56|2425 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|27 52|M13 reverse primer 53|1 55|157 56|173 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|pUC origin 53|0 55|1216 56|1889 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|2319 56|2362 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|2160 56|2187 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|27 52|T7 primer 53|1 55|133 56|152 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|136 56|152 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|31 52|TOPO binding site 53|1 55|1 56|5 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2460000" 50 45 51|31 52|TOPO binding site 53|0 55|2593 56|2597 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2470000" 50 45 51|9 52|T7 gene 10 translational enhancer 53|0 55|2576 56|2584 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000007" 50 45 51|32 52|RBS 53|0 55|2586 56|2592 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000003" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|aagggtgggcgcgccgacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgta 209|gccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtacaaaaaagcaggctccgcggccgccttgtttaactttaagaaggagcccttcacc 210 212 25|pENTR11 278|GenBank 27|0 222|1 33|2744 236|38836800 237|326807315 26|948 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|2744 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="585" 50 45 51|86 52|attL1 53|0 55|358 56|457 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attL2 53|1 55|973 56|1072 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 45 51|4 52|ccdB 53|0 55|639 56|944 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Kan(R) 53|0 55|1195 56|2004 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|33 52|pUC origin 53|0 55|2068 56|2741 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|106 56|149 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|281 56|308 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgctagcatggatctcggggacgtctaactactaagcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcggaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgtgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaactaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttcctgttagttagttacttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgataagcaatgcttttttataatgccaactttgtacaaaaaagcaggcttcgaaggagatagaaccaattctctaaggaaatacttaaccatggtcgactggatccggtaccgaattcgcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgcttctagaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatagtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatatagaattcgcggccgcactcgagatatctagacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcag 209|actaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacattattcagattgggccccgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR1A 278|GenBank 27|0 222|1 33|2717 236|38836800 237|326807316 26|949 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|2717 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="587" 50 45 51|86 52|attL1 53|0 55|358 56|457 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attL2 53|1 55|946 56|1045 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 45 51|4 52|ccdB 53|0 55|612 56|917 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Kan(R) 53|0 55|1168 56|1977 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|33 52|pUC origin 53|0 55|2041 56|2714 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|106 56|149 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|281 56|308 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgctagcatggatctcggggacgtctaactactaagcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcggaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgtgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaactaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttcctgttagttagttacttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgataagcaatgcttttttataatgccaactttgtacaaaaaagcaggctttaaaggaaccaattcagtcgactggatccggtaccgaattcgcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgcttctagaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatagtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatatagaattcgcggccgcactcgagatatctagacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcc 209|tcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgtccctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacattattcagattgggccccgttccactgagcgtcagacccggtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR221 278|GenBank 27|0 222|1 33|2546 236|38836800 237|326807316 26|950 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 756 53|0 55|1 56|2546 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="756" 50 45 51|86 52|attL1 53|0 55|569 56|668 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attL2 53|1 55|671 56|770 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 45 51|4 52|Kan(R) 53|0 55|940 56|1749 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|27 52|M13 (-20) forward primer 53|0 55|537 56|552 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|0 55|517 56|533 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|27 52|M13 reverse primer 53|1 55|811 56|827 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2010000" 50 45 51|33 52|pUC origin 53|0 55|1870 56|2543 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 transcription terminator 53|0 55|427 56|470 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|0 55|268 56|295 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 45 51|27 52|T7 primer 53|1 55|787 56|806 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|790 56|806 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgttaacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgcttttttataatgccaactttgtacaaaaaagcaggcaccacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgatatcccctatagtgagtcgtattacatggtcatagctgtttcctggcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaat 209|gaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacgggacggcgcaagctcatgaccaaaatcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR2B 278|GenBank 27|0 222|1 33|2718 236|38836800 237|326807316 26|951 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|2718 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="577" 50 45 51|86 52|attL1 53|0 55|358 56|457 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attL2 53|1 55|947 56|1046 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 45 51|4 52|ccdB 53|0 55|613 56|918 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Kan(R) 53|0 55|1169 56|1978 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|33 52|pUC origin 53|0 55|2042 56|2715 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|106 56|149 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|281 56|308 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgctagcatggatctcggggacgtctaactactaagcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcggaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgtgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaactaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttcctgttagttagttacttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgataagcaatgcttttttataatgccaactttgtacaaaaaagcaggctggcgccggaaccaattcagtcgactggatccggtaccgaattcgcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgcttctagaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatatagaattcgcggccgcactcgagatatctagacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgc 209|ctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacattattcagattgggccccgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR3C 278|GenBank 27|0 222|1 33|2723 236|38836800 237|326807316 26|952 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|2723 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="563" 50 45 51|86 52|attL1 53|0 55|358 56|457 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attL2 53|1 55|952 56|1051 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 45 51|4 52|ccdB 53|0 55|618 56|923 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Kan(R) 53|0 55|1174 56|1983 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|33 52|pUC origin 53|0 55|2047 56|2720 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|106 56|149 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|281 56|308 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgctagcatggatctcggggacgtctaactactaagcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcggaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgtgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaactaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttcctgttagttagttacttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgataagcaatgcttttttataatgccaactttgtacaaaaaagcaggctctttaaaggaaccaattcagtcgactggatccggtaccgaattcgatcgcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgcttctagaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatatagaattcgcggccgcactcgagatatctagacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatt 209|tatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacattattcagattgggccccgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pENTR4 278|GenBank 27|0 222|1 33|2720 236|38836800 237|326807316 26|953 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|2720 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="588" 50 45 51|86 52|attL1 53|0 55|358 56|457 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2670000" 50 45 51|86 52|attL2 53|1 55|949 56|1048 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2680000" 50 45 51|4 52|ccdB 53|0 55|615 56|920 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Kan(R) 53|0 55|1171 56|1980 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1210000" 50 45 51|33 52|pUC origin 53|0 55|2044 56|2717 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|43 52|rrnB T1 transcription terminator 53|1 55|106 56|149 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2580000" 50 45 51|43 52|rrnB T2 transcription terminator 53|1 55|281 56|308 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2590000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|ctttcctgcgttatcccctgattctgtggataaccgtattaccgctagcatggatctcggggacgtctaactactaagcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcggaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgtgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaactaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttcctgttagttagttacttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgataagcaatgcttttttataatgccaactttgtacaaaaaagcaggctccaccatgggaaccaattcagtcgactggatccggtaccgaattcgcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgcttctagaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatatagaattcgcggccgcactcgagatatctagacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgcagctctggcccgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcgaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttat 209|gcctcttccgaccatcaagcattttatccgtactcctggtgatgcatggttactcaccactgcgatccccggaaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacattattcagattgggccccgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt 210 212 25|pET104-DEST 278|GenBank 27|0 222|1 33|7618 236|38836800 237|326807316 26|957 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 745 53|0 55|1 56|7618 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="745" 50 45 51|4 52|Amp(R) 53|0 55|2806 56|3666 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|561 56|685 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2120 56|2244 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|4 52|BioEase™ tag 53|0 55|300 56|515 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1040000" 50 45 51|27 52|BioEase™ forward primer 53|0 55|493 56|510 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1920000" 50 45 51|30 52|bla promoter 53|0 55|2707 56|2805 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1774 56|2079 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|794 56|1453 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|EK recognition site 53|0 55|537 56|551 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1100000" 50 45 51|31 52|lac operator 53|0 55|228 56|252 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2430000" 50 45 51|33 52|pBR322 origin 53|0 55|3811 56|4484 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|4 52|ROP 53|1 55|4855 56|5046 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1270000" 50 45 51|27 52|T7 primer 53|0 55|209 56|228 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|209 56|225 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|27 52|T7 reverse primer 53|1 55|2313 56|2332 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2110000" 50 45 51|43 52|T7 transcription terminator 53|0 55|2274 56|2402 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2630000" 50 45 51|4 52|Xpress™ epitope 53|0 55|528 56|551 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1360000" 50 45 51|4 52|lacI 53|1 55|6358 56|7449 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1220000" 50 45 51|32 52|RBS 53|0 55|282 56|288 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000003" 50 45 51|4 52|initiation ATG 53|0 55|297 56|299 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|caaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatatacatatgggcgccggcaccccggtgaccgccccgctggcgggcactatctggaaggtgctggccagcgaaggccagacggtggccgcaggcgaggtgctgctgattctggaagccatgaagatggaaaccgaaatccgcgccgcgcaggccgggaccgtgcgcggtatcgcggtgaaagccggcgacgcggtggcggtcggcgacaccctgatgaccctggcgggctctggatccgatctgtacgacgatgacgataagggaattatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggca 209|gaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttactaaaagccagataacagtatgcgtatttgcgcgcaccggtgctagcgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgataattaattaagatagctcagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagctagcttatcgatgataagctgtcaaacatgagaattaattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaagga 209|agagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctac 209|accgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggttt 209|gcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgagatcccggtgcctaatgagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccgagatatccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtctggtcagagacatcaaga 209|aataacgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtccgggatctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatg 210 212 25|pEXP1-DEST 278|GenBank 27|0 222|1 33|4622 236|38836800 237|326807316 26|960 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 684 53|0 55|1 56|4622 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="684" 50 45 51|4 52|6xHis 53|0 55|112 56|129 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1000000" 50 45 51|4 52|Amp(R) 53|0 55|2768 56|3628 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|202 56|326 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|1782 56|1906 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|2669 56|2767 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1436 56|1741 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|435 56|1094 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|4 52|EK recognition site 53|0 55|178 56|192 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1100000" 50 45 51|33 52|f1 origin 53|0 55|2127 56|2582 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|33 52|pUC origin 53|0 55|3773 56|4446 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|27 52|T7 primer 53|0 55|20 56|39 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|20 56|36 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|27 52|T7 reverse primer 53|1 55|1966 56|1985 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2110000" 50 45 51|43 52|T7 transcription terminator 53|0 55|1927 56|2056 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2640000" 50 45 51|4 52|Xpress™ epitope 53|0 55|169 56|192 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1360000" 50 45 51|27 52|Xpress™ forward primer 53|0 55|132 56|150 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2150000" 50 45 51|32 52|RBS 53|0 55|85 56|92 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000003" 50 45 51|4 52|initiation ATG 53|0 55|100 56|102 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gatctcgatcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacatatgcggggttctcatcatcatcatcatcatggtatggctagcatgactggtggacagcaaatgggtcgggatctgtacgacgatgacgataaggatcatcaaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatctagaggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaa 209|cggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttcgatcgaagcttgatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggatctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagagctttacggcacctcgaccgcaaaaaacttgatttgggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatcgcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaatatttaacgcgaattttaacaaaatattaacgtttacaatttcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatacaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttatt 209|cccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagagtgacaccacgatgcctgtagcaatgccaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagcgctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaag 209|cgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctgggcttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgca 210 212 25|pEXP2-DEST 278|GenBank 27|0 222|1 33|4403 236|38836800 237|326807316 26|961 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Source_1 53|0 55|1 56|4403 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="686" 50 45 51|4 52|6xHis 53|0 55|1873 56|1890 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1010000" 50 45 51|4 52|Amp(R) 53|0 55|2551 56|3411 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|98 56|222 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|1678 56|1802 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|2059 56|2155 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1332 56|1637 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|331 56|990 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|33 52|pUC origin 53|0 55|3556 56|4226 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|27 52|T7 primer 53|0 55|20 56|39 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|0 55|20 56|36 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|43 52|T7 transcription terminator 53|0 55|1928 56|2012 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2610000" 50 45 51|27 52|V5 reverse primer 53|1 55|1831 56|1851 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|1822 56|1863 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|4 52|Zeo(R) 53|0 55|2156 56|2530 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1370000" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|gatctcgatcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggaattatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgat 209|attattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgataattcgaagcttgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaactatatagaataaaagaagaaaccttagctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggattaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatgtgaggagggccaccatggccaagttgaccagtgccgttccggtgctcaccgcgcgcgacgtcgccggagcggtcgagttctggaccgaccggctcgggttctcccgggacttcgtggaggacgacttcgccggtgtggtccgggacgacgtgaccctgttcatcagcgcggtccaggaccaggtggtgccggacaacaccctggcctgggtgtgggtgcgcggcctggacgagctgtacgccgagtggtcggaggtcgtgtccacgaacttccgggacgcctccgggccggccatgaccgagatcggcgagcagccgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggactgacacattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacg 209|ccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagagtgacaccacgatgcctgtagcaatgccaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacgcgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagacgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctg 209|gccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcag 210 212 25|pLenti6/V5-DEST 278|GenBank 27|0 222|1 33|8688 236|38836800 237|326807317 26|968 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 765 53|0 55|1 56|8688 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="765" 50 45 51|19 52|deltaU3/3' LTR 53|0 55|5209 56|5442 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1390000" 50 45 51|4 52|Amp(R) 53|0 55|6603 56|7463 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|2440 56|2564 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|4020 56|4144 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|6504 56|6602 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|Bsd(R) 53|0 55|4724 56|5122 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1050000" 50 45 51|4 52|ccdB 53|0 55|3674 56|3979 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|2673 56|3332 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|CMV forward primer 53|0 55|2274 56|2294 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|29 52|CMV promoter 53|0 55|1809 56|2391 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2170000" 50 45 51|19 52|deltaU3 53|0 55|5208 56|5261 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1410000" 50 45 51|30 52|EM7 promoter 53|0 55|4656 56|4723 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2340000" 50 45 51|33 52|f1 origin 53|0 55|6017 56|6472 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|19 52|HIV-1 5' LTR 53|0 55|230 56|410 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1430000" 50 45 51|19 52|HIV-1 3' LTR 53|0 55|5262 56|5442 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1430000" 50 45 51|20 52|HIV-1 psi packaging signal 53|0 55|521 56|565 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1780000" 50 45 51|33 52|pUC origin 53|0 55|7608 56|8281 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|31 52|HIV-1 Rev response element 53|0 55|1075 56|1308 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2440000" 50 45 51|29 52|RSV promoter 53|0 55|1 56|229 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2270000" 50 45 51|29 52|RSV/5' LTR hybrid promoter 53|0 55|1 56|410 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2280000" 50 45 51|25 52|SV40 pA 53|0 55|5514 56|5644 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1840000" 50 45 51|27 52|V5 reverse primer 53|1 55|4206 56|4226 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|4 52|V5 epitope 53|0 55|4197 56|4238 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|38 52|splice donor 53|0 55|520 56|520 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000012" 50 45 51|38 52|splice acceptor 53|0 55|1656 56|1656 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000013" 50 45 51|38 52|splice acceptor 53|0 55|1684 56|1684 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000014" 50 45 51|41 52|TATA box 53|0 55|2309 56|2312 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000002" 50 45 51|29 52|SV40 early promoter 53|0 55|4293 56|4602 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2290000" 50 45 51|4 52|3 stops 53|0 55|4248 56|4256 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000001" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|aatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttgga 209|atcacacgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcgataagcttgggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgactctagaggatccactagtccagtgtggtggaattctgcagatatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggc 209|ctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatatccagcacagtggcggccgctcgagtctagagggcccgcggttcgaaggta 209|agcctatccctaaccctctcctcggtctcgattctacgcgtaccggttagtaatgagtttggaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctgcatcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtgggagggctaagcacaattcgagctcggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattct 209|agttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggc 209|caacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcgg 209|aagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctgcaagctt 210 212 25|pT-REx-DEST30 278|GenBank 27|0 222|1 33|7544 236|38836800 237|326807317 26|975 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|0 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 42|Plasmid 43|Bacteria|Animal/Other Eukaryotic 1001|0 1006|28-AUG-2003 1008|SYN 45 51|98 52|Invitrogen vector 465 53|0 55|1 56|7544 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="465" 50 45 51|4 52|Amp(R) 53|0 55|5474 56|6334 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1020000" 50 45 51|86 52|attR1 53|0 55|699 56|823 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|86 52|attR2 53|1 55|2279 56|2403 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|30 52|bla promoter 53|0 55|5375 56|5473 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2330000" 50 45 51|4 52|ccdB 53|0 55|1933 56|2238 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1060000" 50 45 51|4 52|Cm(R) 53|0 55|932 56|1591 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1080000" 50 45 51|27 52|CMV forward primer 53|0 55|467 56|487 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1930000" 50 45 51|33 52|f1 origin 53|0 55|3175 56|3630 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2520000" 50 45 51|27 52|M13 (-20) forward primer 53|1 55|2495 56|2510 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1980000" 50 45 51|27 52|M13 (-40) forward primer 53|1 55|2514 56|2530 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2000000" 50 45 51|4 52|Neo(R) 53|0 55|4157 56|4951 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1260000" 50 45 51|25 52|synthetic pA 53|0 55|5015 56|5063 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1820000" 50 45 51|33 52|pUC origin 53|0 55|6479 56|7152 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2540000" 50 45 51|25 52|SV40 pA 53|0 55|2783 56|3049 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="1830000" 50 45 51|27 52|T7 primer 53|1 55|2464 56|2483 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2100000" 50 45 51|30 52|T7 promoter 53|1 55|2467 56|2483 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2370000" 50 45 51|31 52|TetR binding sites 53|0 55|518 56|557 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2450000" 50 45 51|29 52|CMV promoter (with TetOs) 53|0 55|1 56|588 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="2195000" 50 45 51|29 52|SV40 early promoter 53|0 55|3790 56|4098 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="229000" 50 45 51|41 52|TATA box 53|0 55|502 56|508 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="123000002" 50 205 37|0 38|0 39|0 40|0 1024|-1 24 209|atgcatgtcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctccctatcagtgatagagatctccctatcagtgatagagatcgtcgacgagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggactctagaggatccctaccggtgatatcctcgagcccatcaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttg 209|atttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggttgatgggcggccgctctagagggcccaagcttacgcgtgcatgcgacgtcatagctctctccctatagtgagtcgtattataagctaggcactggccgtcgttttacaacgtcgtgactgggaaaactgctagcttgggatctttgtgaaggaaccttacttctgtggtgtgacataattggacaaactacctacagagatttaaagctctaaggtaaatataaaatttttaagtgtataatgtgttaaactagctgcatatgcttgctgcttgagagttttgcttactgagtatgatttatgaaaatattatacacaggagctagtgattctaattgtttgtgtattttagattcacagtcccaaggctcatttcaggcccctcagtcctcacagt 209|ctgttcatgatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatcgatcctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattggctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaatatttaacgcgaattttaacaaaatattaacgtttacaatttcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatacgcggatctgcgcagcaccatggcctgaaataacctctgaaagaggaacttggttaggtaccttctgaggcggaaagaaccagctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagcttgattcttctgacacaacagtctcgaacttaaggctagagccaccatgattgaacaagatggattgcacgcaggttctccggccgcttg 209|ggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgatggccgcaataaaatatctttattttcattacatctgtgtgttggttttttgtgtgaatcgatagcgataaggatccgcgtatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgg 209|gttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaac 209|gcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagagcttgcaattcgcgcgtttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtagtacgaggccctttcactcattag 210 212 25|BaculoDirect Linear DNA Cloning Fragment DNA 27|1 222|1 33|5770 236|38836800 237|326807317 26|979 28|0 219|0 220|1 221|1 29|0 30|0 217|0 31|1 32|1 255 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 256 224|Invitrogen 225|(760)603-7200 226|(760)602-6500 227|tech_service@invitrogen.com 229|http://www.invitrogen.com 230|Invitrogen Corporation 231|1620 Faraday Avenue 232|Carlsbad, CA 92008, U.S.A. 50 1001|0 45 51|98 52|Invitrogen vector 757 53|0 55|1 56|5770 57|0 281|1 282|1 283|1 284|1 286|/invitrogen="757" 50 45 51|86 52|attR2 53|0 55|5546 56|5670 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="2700000" 50 45 51|4 52|V5 epitope 53|0 55|5690 56|5731 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="1350000" 50 45 51|86 52|attR1 53|0 55|178 56|302 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="2690000" 50 45 51|4 52|lacZ 53|0 55|2456 56|5530 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="1230000" 50 45 51|4 52|TK gene 53|1 55|589 56|1719 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="1320000" 50 45 51|29 52|ie-0 promoter 53|1 55|1748 56|2299 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="2230000" 50 45 51|29 52|p10 promoter 53|0 55|2347 56|2444 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="2240000" 50 45 51|29 52|PH promoter 53|0 55|29 56|157 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="2260000" 50 45 51|4 52|6xHis 53|0 55|5741 56|5758 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="1010000" 50 45 51|27 52|V5 reverse primer 53|0 55|5699 56|5719 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="2140000" 50 45 51|27 52|Polyhedrin forward primer 53|0 55|45 56|62 57|1 281|1 282|1 283|1 284|1 286|/invitrogen="2060000" 50 45 51|21 52|boundary between His tag and native baculovirus 53|0 55|5770 56|5770 57|1 281|1 282|1 283|1 284|1 50 205 47 59|3 218|1 60|0 61|0 63|0 70|BaculoDirect Linear DNA 72|0 73|0 74|1 75|5770 76|1 77|5770 78|4400 79|10169 80|0 84 91|2 92|0 93|4400 96|0 97|0 98|0 99|0 100|0 101|0 102|0 103|0 104|0 105|0 50 85 91|2 92|1 93|10169 96|0 97|0 98|0 99|0 100|0 101|0 102|0 103|0 104|0 105|0 50 50 37|0 38|0 39|0 40|0 1024|-1 24 209|aaatgtctatcaatatatagttgctgatatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggcgcggatccccgggtaccgatatcacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatggcggccgctccctaacccacggggcccgtggctatggcagggcttgccgccccgacgttggctgcgagccctgggccttcacccgaacttgggggttggggtggggaaaaggaagaaacgcgggcgtattggtcccaatggggtctcggtggggtatcgacagagtgccagccctgggaccgaaccccgcgtttatgaacaaacgacccaacacccgtgcgttttattctgtctttttattgccgtcatagcgcgggttccttccggtattgtctccttccgtgtttcagttagcctcccccatctcccgggcaaacgtgcgcgccaggtcgcagatcgtcggtatggagcctggggtggtgacgtgggtctggaccatcccggaggtaagttgcagcagggcgtcccggcagccggcgggcgattggtcgtaatccaggataaagacatgcatgggacggaggcgtttggccaagacgtccaaagcccaggcaaacacgttatacaggtcgccgttgggggccagcaactcgggggcccgaaacagggtaaataacgtgtccccgatatggggtcgtgggcccgcgttgctctggggctcggcaccctggggcggcacggccgcccccgaaagctgtccccaatcctcccgccacgacccgccgccctgcagataccgcaccgtattggcaagcagcccataaacgcggcgaatcgcggccagcatagccaggtcaagccgctcgccggggcgctggcgtttggccaggcggtcgatgtgtctgtcctccggaagggcccccaacacgatgtttgtgccgggcaaggtcggcgggatgagggccacgaacgccagcacggcctggggggtcatgctgcccataaggtatcgcgcggccgggtagcacaggagggcggcgatgggatggcggtcgaagatgagggtgagggccgggggcggggcatgtgagctcccagcctcccccccgatatgaggagccagaacggcgtcggtcacggcataaggcatgcccattgttatctgggcgcttgtcattaccaccgccgcgtccccggccgatatctcaccctggtcga 209|ggcggtgttgtgtggtgtagatgttcgcgattgtctcggaagcccccaacacccgccagtaagtcatcggctcgggtacgtagacgatatcgtcgcgcgaacccagggccaccagcagttgcgtggtggtggttttccccatcccgtggggaccgtctatataaacccgcagtagcgtgggcattttctgctccaggcggacttccgtggctttttgttgccggcgagggcgcaacgccgtacgtcggttgttatggccgcgagaacgcgcagcctggtcgaacgcagacgcgtgttgatggcaggggtacgaagccatagatcccgttatcaattacttatactatccggcgcgcaagcgagcgtgtgcgccggagcacaattgatactgatttacgagttgggcaaacgggctttatatagcctgtcccctccacagccctagtgccgtgcgcaaagtgcctacgtgaccaggctctcctacgcatatacaatcttatctctatagataaggtttccatatataaagcctctcgatggctgaacgtgcacagtatcgtgttgatttctgagtgctaactaacagttacaatgaaccgtttttttcgagagaataacatttttgacgcgccaaggaccgggggcaagggtcgtgccaaatctttgccagcgcctgccgccaactcgccgccgtcgcctgttcgtccgccgccaaaatctaacatcaaaccacctacgcgcatctctccgcctaaacagcctatgtgcacctctccggccaagccgttggagcacagcagcattgtaagtaaaaaaccagtcgtcaacagaaaagatggatattttgtgccgcccgagtttgggaacaagtttgaaggtttgcccgcgtacagcgacaaactggatttcaaacaagagcgcgatctacgtacctgcaggcccgggctcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaattcactctagaatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctacaccaacgtaacctatcccattacggtcaatccgccgtttgtt 209|cccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgttggagtgacggcagttatctggaagatcaggatatgtggcggatgagcggcattttccgtgacgtctcgttgctgcataaaccgactacacaaatcagcgatttccatgttgccactcgctttaatgatgatttcagccgcgctgtactggaggctgaagttcagatgtgcggcgagttgcgtgactacctacgggtaacagtttctttatggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaattatcgatgagcgtggtggttatgccgatcgcgtcacactacgtctgaacgtcgaaaacccgaaactgtggagcgccgaaatcccgaatctctatcgtgcggtggttgaactgcacaccgccgacggcacgctgattgaagcagaagcctgcgatgtcggtttccgcgaggtgcggattgaaaatggtctgctgctgctgaacggcaagccgttgctgattcgaggcgttaaccgtcacgagcatcatcctctgcatggtcaggtcatggatgagcagacgatggtgcaggatatcctgctgatgaagcagaacaactttaacgccgtgcgctgttcgcattatccgaaccatccgctgtggtacacgctgtgcgaccgctacggcctgtatgtggtggatgaagccaatattgaaacccacggcatggtgccaatgaatcgtctgaccgatgatccgcgctggctaccggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctggggaatgaatcaggccacggcgctaatcacgacgcgctgtatcgctggatcaaatctgtcgatccttcccgcccggtgcagtatgaaggcggcggagccgacaccacggccaccgatattatttgcccgatgtacgcgcgcgtggatgaagaccagcccttcccggctgtgccgaaatggtccatcaaaaaatggctttcgctacctggagagacgcgcccgctgatcctttgcgaatacgcccacgcgatgggtaacagtcttggcggtttcgctaaatactggcaggcgtttcgtcagtatccccgtttacagggcggcttcgtctgggactgggtggatcagtcgctgattaaatatgatgaaaa 209|cggcaacccgtggtcggcttacggcggtgattttggcgatacgccgaacgatcgccagttctgtatgaacggtctggtctttgccgaccgcacgccgcatccagcgctgacggaagcaaaacaccagcagcagtttttccagttccgtttatccgggcaaaccatcgaagtgaccagcgaatacctgttccgtcatagcgataacgagctcctgcactggatggtggcgctggatggtaagccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggtaaacagttgattgaactgcctgaactaccgcagccggagagcgccgggcaactctggctcacagtacgcgtagtgcaaccgaacgcgaccgcatggtcagaagccgggcacatcagcgcctggcagcagtggcgtctggcggaaaacctcagtgtgacgctccccgccgcgtcccacgccatcccgcatctgaccaccagcgaaatggatttttgcatcgagctgggtaataagcgttggcaatttaaccgccagtcaggctttctttcacagatgtggattggcgataaaaaacaactgctgacgccgctgcgcgatcagttcacccgtgcaccgctggataacgacattggcgtaagtgaagcgacccgcattgaccctaacgcctgggtcgaacgctggaaggcggcgggccattaccaggccgaagcagcgttgttgcagtgcacggcagatacacttgctgatgcggtgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttatttatcagccggaaaacctaccggattgatggtagtggtcaaatggcgattaccgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcctgaactgccagctggcgcaggtagcagagcgggtaaactggctcggattagggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcgaaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaactgatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggctgaatatcgacggtttccatatggggattggtggcgacgactcctggagcccgtcagtatcggcggaattccagctgagcgccggtcgctaccattaccagttggtctggtgtcaaaaataatgactgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgca 209|aaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgagaatgaatgaagatctggggaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgaagatctgat 210 207